1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naya [18.7K]
3 years ago
9

Name two of the tangible and/or intangible ways in which state governments improve society.

Biology
1 answer:
Mrrafil [7]3 years ago
3 0
Two of the tangible and/or intangible ways in which state governments improve society regulation of currency and promotion of freedom and equality. I hope this is the answer that you are looking for and it comes to your help.
You might be interested in
Suppose your eyes are exposed to a microorganism, what is the first thing you should do?
Viktor [21]

If your eyes are exposed to a microorganism, the first thing you should do is to <u>Flush your eyes with water for at least 10-15 minutes. </u>

<u />

  • Proper eyelid cleanliness stops the bacterial buildup that leads to blepharitis and the potential for Demodex.
  • Maintaining clean eyelids and lashes is also essential for safeguarding the many glands that line our eyelids and aid in the production of our tears.
  • To allow the fluid to move across the eye, someone should flush their eye for 10 to 15 minutes while attempting to keep their eyes open.
  • Some chemicals, such strong alkalis, may call for 60 minutes of flushing.
  • When flushing the eye, one should make sure there are no chemicals or debris under the eyelid by looking around. They might want to get medical help after flushing.

learn more about eyes here: brainly.com/question/1688036

#SPJ4

<u />

8 0
11 months ago
Time._______________
Alecsey [184]

Answer: choice B. Climate

Explanation:

Climate is the relative temperature of a region over time.

3 0
2 years ago
Which is a process involved in the formation of sedimentary rock?
Brilliant_brown [7]
COMPACTION.

Sedimentary rock is a rock formed by layers of sediments settling down together forming one solid rock.


Hope it helped,

Happy homework/ study/ exam!
8 0
3 years ago
Read 2 more answers
During which phase does a cell usually leave the cell cycle
vodka [1.7K]

Answer:

mitosis

Explanation:

7 0
3 years ago
Read 2 more answers
Hailstones do a lot of damage when they fall to the Earth and hit homes and cars with great force they hit was great force becau
monitta

They accelerate as they fall to Earth

6 0
3 years ago
Read 2 more answers
Other questions:
  • Why is salt used for DNA isolation?
    12·1 answer
  • Large doses of antibiotics given to fight an infection are likely to destroy bacteria that produce vitamin K. In which digestive
    13·1 answer
  • According to the text's definition, nutrition is "the proper supply of nutrients essential for": growth reproduction circulation
    8·2 answers
  • Genetic engineering has the potential to correct
    13·2 answers
  • How does a hockey puck describe newtons laws of motion
    6·1 answer
  • Which phrase describes organisms that formed index fossils?
    9·2 answers
  • Do molecules move down their concentration gradient
    11·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How does simple diffusion differ from facilitated diffusion
    5·1 answer
  • (PLS HELP! I NEED THE CORRECT ANSWER &lt;3)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!