1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
3 years ago
11

Which area would have the highest salinity? an area with plenty of runoff an area with high rates of evaporation an area with hi

gh rates of precipitation
Biology
2 answers:
Makovka662 [10]3 years ago
8 0

Answer: high rates of evaporation

Salinity is the measure of amount of salt dissolved in the water. The area with a plenty of run off will have very low salinity as the run off will take away the surface particles might be containing salt in it. The area with high rates of precipitation will have very low salinity this is because of the fact that the rainfall will take away the salts present on the surface to other location because of water erosion.

The area with high rates of evaporation will have highest salinity because the water or other liquid components gets removed from the surface leaving behind all the solid sediments which may also include salts.

Shtirlitz [24]3 years ago
6 0

An area with high rates of evaporation. Since evaporation takes away water and leaves the salt.

You might be interested in
Based on the trilobite fossil, what can you infer about the rock layers in these location? Layer a is 500 million years old. Lay
frozen [14]

Answer: Layer a is 500 million years old.

Explanation:

Trilobite is a member of the group of extinct arthropods found as fossils and they can be identified by the three-lobed as well as three segmented forms. These were the marine animals. These were appeared initially in the Cambrian Period. They used to live 542 million years ago so the fossils can be estimated to be aged of 500 above years old. These animals used to dominate in the sea area.

5 0
2 years ago
Agricultural lands frequently require nutrient augmentation because
fenix001 [56]

The given is incomplete as the options are missing. The correct options for the given question are as follows-

(A) cultivation of agricultural land inhibits the decomposition of organic matter

(B) nitrogen-fixing bacteria are not as plentiful in agricultural soils because of the use of pesticides

(C) land that is available for agriculture tends to be nutrient-poor

(D) the nutrients that become the biomass of plants are not cycled back to the soil on lands where they are harvested

Answer:

Option (D)

Explanation:

In order to carry out agricultural practices, the soil must be rich in essential nutrients for the growth of crops. The soil fertility is a key role in the production of crops.

This agricultural land often requires a large amount of these nutrients and minerals because some of the nutrient minerals are converted into plant biomass which is then used up to produce energy in other sectors. So, the nutrients that were present in the soil are taken away and not transferred back into the soil. This means that the nutrient cycle gets affected. Due to this reason, there requires a constant supply of nutrients into the agricultural fields.

Thus, the correct answer is option (D).

8 0
3 years ago
This type of energy splits nuclei or combines them
hjlf

Answer:

B. Nuclear energy

this type of energy splits nuclei or combines them.

4 0
3 years ago
Read 2 more answers
What type of plate boundary could form a mountain chain of sedimentary rock? PLEASE ANSWER NOW 
Dima020 [189]
The answer is C i loooked it up 
6 0
3 years ago
What does vain mean in the poem?
Inessa05 [86]

Answer:

D. Useless

Explanation:

According to Dictionary.com, “in vain” is defined as “without real significance, value, or importance; baseless or worthless.”

7 0
3 years ago
Other questions:
  • Explain how scientific investigations that preceded Lamarck , contributed to the development of his theory of evolution
    10·2 answers
  • You are developing a new drug that damages the cells that provide the supportive structure required by a tumor. which type of ce
    9·1 answer
  • Why do scientists use six kingdoms
    8·2 answers
  • Which of these CORRECTLY explains the difference between the processes of photosynthesis and respiration?
    12·1 answer
  • Main functions of vacuoles
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • During the course of a physical exam, a physician suspects his patient may be depressed. In order to explore this diagnostic pos
    6·1 answer
  • Why are photosynthesis and cellular respiration viewed as complementary processes?
    9·1 answer
  • HELP ME OUT PLEASE
    13·1 answer
  • Humans store excess polysaccharides in the form of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!