1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
4 years ago
9

What are the functions of spirogyra?

Biology
2 answers:
Aloiza [94]4 years ago
7 0
Spirogyra<span> is a genus of filamentous charophyte green algae of the order Zygnematales, named for the helical or spiral arrangement of the chloroplasts that is diagnostic of the genus.

</span>
Vadim26 [7]4 years ago
3 0
A genus of filamentous green algae, named for the spiral arrangement of the chloroplast that is diagnostic of the genus. It is commonly found in freshwater<span> areas,</span>
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
ONE FOOD CHAIN that was affected by the introduction of wolves and model it
MAVERICK [17]

Answer:

Carnivorous

Explanation:

The wolf, also known as the gray wolf or grey wolf, is a large canine native to Eurasia and North America. More than thirty subspecies of Canis lupus have been recognized, and gray wolves, as colloquially understood, comprise non-domestic/feral subspecies. Wikipedia

4 0
3 years ago
Explain why the photic and aphotic zones of marine biomes are interdependent
andriy [413]
Since the aphotic zone does not recieve sunlight it relys on the photic zone for the sunlight which in terms it does penetrate.
4 0
3 years ago
Read 2 more answers
suggest and explain how the flow of blood in a person with patent ductus arteriosus differs from that of a person with a healthy
iren2701 [21]
Ductus Arteriosus is a blood vessel normally present in fetuses during development. The blood vessel is designed to bypass the pulmonary artery and brings blood to the Descending Aorta, as the fetus cannot breath through the lung (being as they are fluid filled). This is normally not a problem because oxygenated blood comes from the mother's blood supply.

Patent Ductus Arteriosus, is what happens when that vessel does not close. While not as dangerous as other congenital defects. However, because there is still a bypass, blood that normally need to be oxygenated by going through the pulmonary arteries to the lungs, can be diverted and placed into the blood stream without vital oxygen. This condition may eventually lead to CHF (congestive Heart Failure) and Pulmonary Hypertension if not treated.
6 0
3 years ago
Can someone help me pleasee
Greeley [361]

Answer:

the answer is true trust me

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which is a carbohydrate monomer?<br> O glucose<br> O sucrose<br> O glucagon<br> O glycogen
    14·1 answer
  • Omar wrote a hypothesis about batteries called dry cells.
    14·2 answers
  • Lucia ran a 5k on a hot afternoon. a few hours later, the muscles in her legs began to spasm painfully. what condition was lucia
    12·1 answer
  • While an important source of freshwater, groundwater is not as widely used as rivers and springs.
    13·2 answers
  • Most of the nucleated cells in a multicellular organism contain all of the genetic information for the organism. Which of the fo
    15·1 answer
  • A researcher has identified a gene linked to a neurodegenerative disease. In individuals that suffer symptoms of this disease, a
    14·1 answer
  • An energy pyramid is a graphical model of energy flow in a community. The different levels represent different groups of organis
    8·2 answers
  • Why should we try to improve the use of today’s antibiotics ?
    7·2 answers
  • Active transport differs from passive transport in that energy in the form of ____ is used to move molecules across the membrane
    14·1 answer
  • Determine whether each statement is true or false according to Darwin’s theory.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!