1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
12

30 points Plzzzzz hurrrrryyyy test is in 5 minutes. Answer correctly too!!!! Will mark as brainliest Based on the map, IDENTIFY

one human activity that could have a negative effect on the Nature Preserve.

Biology
1 answer:
I am Lyosha [343]3 years ago
7 0

Answer:

Housing development and shopping mall

Explanation:

housing development and shopping mall may cause wildlife habitats destroyed. also the land being destroyed is not unenvironmetally friendly

You might be interested in
After an investigation, Kuri determines that her hypothesis was wrong. What is the best thing for Kuri to do next?
Artist 52 [7]

Write a new hypothesis and conduct new experiments to explore the matter. Thus, option "B" is correct.

<h3 /><h3>What is the Hypothesis?</h3>

Hypothesis

The formulation of hypotheses is one of the key steps in the scientific method.

Hypotheses are usually tested using experiments and are usually accepted or rejected depending on the outcome of the experiments.

If a hypothesis is rejected, it does not mean that the entire subject is abandoned. Rather, new hypotheses may be formed and experiments conducted to further explore the subject.

More hypotheses can be found here:

brainly.com/question/23056080

#SPJ1

5 0
2 years ago
Which type of macromolecule is made of amino acids?
Rudik [331]
Protein. im absolutely certain
4 0
3 years ago
Read 2 more answers
If you water a plant with salt water, it will wilt, and will eventually die. this is due to the fact that the salt water is a hy
Daniel [21]
What is the question? IDEK

7 0
3 years ago
Which of the following is not a part of environmental science?
zalisa [80]
The answer is letter D.) the components of a cell

Environmental science is an interdisciplinary field that studies the interactions of the environment. The component of a cell can be studied through the lens of biology and may not require addition disciplines.

<span>Thank you for posting your question. I hope you found what you were after. Please feel free to ask me more</span>


8 0
3 years ago
Read 2 more answers
Que atracción tiene el ab positivo con el ab negativo?​
ivanzaharov [21]
What attraction does the positive ab have with the negative ab?
4 0
3 years ago
Other questions:
  • Which current is associated with downslope movements of dense sediment-rich water?
    15·2 answers
  • George has several plants in his garden. Once in a while, he adds fertilizer to the soil. The leaves absorb the nutrients in the
    11·1 answer
  • The sleep cycle is approximately ________ minutes.
    8·1 answer
  • Which best explains how greenhouse gases heat the earth?
    12·2 answers
  • Your colleague asks you to verify her findings about a new polymer intended for use as a vascular graft. It must be reasonably e
    9·1 answer
  • What are the two main functions of DNA​
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • This organelle removes and recycles waste from the cell
    5·2 answers
  • Hair has a medulla region that is variable. Describe the possible variations
    15·1 answer
  • Define anomaly (don't just copy down what's on the website; define. Google if you have to) I need help, it’s for apes
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!