1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
13

What is climate regulation

Biology
1 answer:
Elena-2011 [213]3 years ago
6 0

Answer: Climate regulation is the ecosystem service that regulates processes related to atmospheric chemical composition, the greenhouse effect, the ozone layer, precipitation, air quality, and moderation of temperature and weather patterns (including cloud formation), at both global and local scales.

Also, if there are answer choices, list them in the question aswell.

Hope this helps :)

You might be interested in
What bodies of water may be cold
AlexFokin [52]

Answer:

Flowing rivers and streams,Spring-fed bodies of water,Most open water except in tropical regions,

4 0
3 years ago
Read 2 more answers
3. Explain why some lobsters may have one claw that is larger than the other claw.​
marta [7]

Answer:The larger, more menacing crusher claw also serves as a mating or sexual focus point, apparently the bigger the crusher claw the more attractive male lobsters are to female lobsters. Male lobsters develop proportionately larger claws than females of the same weight once they reach sexual maturity.

4 0
3 years ago
Read 2 more answers
do you guys know what to do? because i definitely don’t. i’m stumped so 20 points if you guys can help me out.
Licemer1 [7]

here you g its here gggggggg

i

6 0
3 years ago
A client has been prescribed librax (chlordiazepoxide + clidinium), an anticholinergic benzodiazepine for irritable bowel syndro
spin [16.1K]
Librax is a medicine which is composed by:
- Chlordiazepoxide: it's a benzodiazepine. All benzodiazepine should never be taken with other drugs because it will major its effects. a person with <span>a history of substance abuse should not take Librax.
- Clidinium: It's a drug with anticholinergic effects, they are known for being avoided in persons with prostate hyperplasia because it will cause </span>urinary retention<span> and glaucoma due to its mydriasis effect.</span>
8 0
3 years ago
What is the difference between longitudinal cross transverse and horizontal cuts?
Charra [1.4K]
Horizontal or transverse or axial cut is if you cutting the object with the horizontal plane. The cut would look like ( -- ). Vertical or longitudinal is cutting in the vertical plane. The cut would look like ( | )
<span>There is also coronal cuts which were a cut with direction from front to back. </span>
4 0
3 years ago
Other questions:
  • What is the difference between an element mixture and compound
    15·2 answers
  • Just like other magnets, the Earth has
    13·1 answer
  • 7. Why is the property of specific heat important to aquatic life?​
    6·1 answer
  • Pluots are a fruit produced by cross-breeding plums and apricots. The outside of the fruit resembles the skin of a plum, while t
    8·1 answer
  • The end of existence of a group of organisms, caused by their inability to adapt to changing environmental conditions, is called
    6·1 answer
  • What is the difference sexual reproduction and asexual reproduction?
    12·2 answers
  • PLZ HELP I'M NOT TRYING TO GO TO SUMMER SCHOOL I WILL BRAINLIST YOU
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What is the complementary DNA strand from the following DNA
    14·2 answers
  • What happens to pyretic acid in the Krebs cycle???, ANSWER AND ILL PUT U ON BRAINLIEST
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!