Answer:
divergent boundary
A divergent boundary occurs when two tectonic plates move away from each other. Along these boundaries, earthquakes are common and magma (molten rock) rises from the Earth's mantle to the surface, solidifying to create new oceanic crust.
Explanation:
Plz give me brainliest worked hard
Answer:
for testing differnt cures on animals
Explanation:
Answer:
20
Explanation:
gametes have half the amount
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
1. They keep casts to preserve the real fossils.
2. Maybe someone would steal a fossil and sell it on the dark web?
3. They keep casts to keep the real fossils in prime condition, by that I mean like undamaged.
