1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
3 years ago
9

Which is a carbohydrate monomer?

Biology
1 answer:
sergeinik [125]3 years ago
3 0
I THINK the answer is <span>monosaccharides</span>
You might be interested in
what do you call the phenomenon When you have a different concentration of materials on the inside and outside of the cell
strojnjashka [21]

Answer: Osmosis

Definition: A process by which molecules of a solvent tend to pass through a semipermeable membrane from a <u>less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membrane.</u>

5 0
4 years ago
Read 2 more answers
The simplicity of prokaryotic cells prevents them from
nexus9112 [7]
No cells that no nucleus
7 0
3 years ago
Read 2 more answers
PLEASE HELP! 30 POINTS!
Dmitriy789 [7]
<h2>Answer:</h2>

The correct options are 1,4 and 5. By looking at phylogenetic tree we can conclude this;

1. Species A and C may have shared features from a common ancestor.

4. Species B and E may have shared features from a common ancestor.

5. Species A is more related to species B than species B is related to species C

<h2 />
5 0
3 years ago
Read 2 more answers
Which organisms externally digest dead organic matter and then absorb the nutrients?
S_A_V [24]
A. community and abiotic environment
6 0
3 years ago
1. Why is it important to the entire scientific community uses the metric system, rather than each country having its choice to
scoundrel [369]

It is important the entire scientific community uses the metric system rather than each country having its own system because when scientist are comparing or sharing results they wont have to do extra steps of converting to different measurements it will just be the same and less confusing.

Explanation:

4 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of these are examples of Newton's 1st law of motion. Check all that apply.
    13·2 answers
  • Which of the following is not one of the unusual characteristics related to the ancient site of Catalhoyuk__________.A. There we
    7·1 answer
  • Which of the following statements is NOT true of protists? Protists can be single-celled or multicellular. Protists can be proka
    10·2 answers
  • General (common) name of your plant/animal and taxonomic species name of your plant/animal
    14·1 answer
  • Explain true or false if you collect organize and interpret your data properly you will always be able to draw a logical conclus
    10·1 answer
  • Tuentlying the importance of Essential Amino Aclay
    5·1 answer
  • What are the genotypes of these flies?
    12·1 answer
  • Approximately how long has the victim been dead if his body temperature was 93.2?
    15·1 answer
  • Complete the T-chart by categorizing each statement as something that would most likely be relevant to gene flow or genetic drif
    16·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!