1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yanalaym [24]
3 years ago
8

Unlike mitosis, meiosis results in the formation of

Biology
2 answers:
TiliK225 [7]3 years ago
5 0
The answer is B........
ankoles [38]3 years ago
3 0
It results in four genetically different cells
You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Many different trees and shrubs live in the Blue Ridge Mountains. This woody habitat supports many types of animals. One species
solniwko [45]
I think if it were me i would pick A
5 0
3 years ago
Read 2 more answers
You are viewing a pedigree and trying to determine the inheritance pattern of a trait. List three characteristics that, if obser
harina [27]

Answer:

X linked inheritance is one of the mechanisms of the inheritance which is associated with the mutation of the gene present on the X chromosome.

The characteristics of the X linked recessive inheritance that must be observed in the pedigree analysis will be-

1. X linked trait is always passed from the mother to the sons (females to males)

2. The males (XY) are usually affected by the gene as only one copy of the recessive gene in males can show its effect.

3. Females are the carrier of the disease but they are not affected by the condition.

8 0
2 years ago
Which regions of the nephron function independently of hormonal control for the most part?
alexgriva [62]

Answer:

Renal corpuscle, proximal tubule, and loop of henle.

Explanation:

Renal corpuscle is blood filtering part of the nephron which consist of Bowman's capsule and glomerulus. It works independently of hormonal control and filter the blood circulate through this glomerulus.

Proximal tubule is the component of nephron which starts from the renal pole of Bowman's capsule to the loop of henle and it involves in the selective reabsorption of glucose, peptides, water and other nutrients from tubule to the blood. It works independently of hormonal control.

Loop of henle is the U shaped part of nephron which is responsible for absorption of water and sodium chloride from urine to back into blood circulation. It is also work independently of hormonal control.

3 0
3 years ago
Read 2 more answers
Muscle cells <br> Function
ivolga24 [154]
What is the question?
5 0
3 years ago
Read 2 more answers
Other questions:
  • List the various organs of breathing system in human
    6·1 answer
  • The predatory bacterium, Bdellovibrio bacteriophorus, drills into a prey bacterium and, once inside, digests it. In an attack up
    9·1 answer
  • Energy is transferred between the atmosphere and hydrosphere by which two processes?
    11·2 answers
  • What strategies will a nurse include when planning an educational program for adults that ensures student learning?
    7·1 answer
  • What is the result of telophase 1 and cytokinesis?
    8·2 answers
  • What is the function of the electron transport system?
    15·1 answer
  • Which of the following statements is true about the scientific process?
    10·1 answer
  • What is the history of Galápagos Islands? I need help!
    13·1 answer
  • How was your eye color determined
    14·1 answer
  • During the __________ stage of the product life cycle, sales peak and profits begin to decline as competition becomes intense. g
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!