1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leonid [27]
3 years ago
9

A man pours some hot coffee into a small cup from a large jug that contains enough coffee for several cups. Which statement corr

ectly compares the coffee in the cup and in the jug?
Chemistry
1 answer:
Stells [14]3 years ago
3 0

Answer:

The correct answer is "The coffee in the jug has more thermal energy than the coffee in the cup".

Explanation:

First I had to look for the problem to know the possible answers.

In this case, the coffee jug has a large amount of coffee at the same temperature. If we analyze that the decanter and the coffee are at the same temperature, we have a homogeneous thermal system. The cup is at room temperature, so by pouring coffee into it, the temperature of the coffee decreases to balance with the temperature of the cup. At this moment, the temperature of the cup-cafe system is lower than the jug-cafe system.

Thermal energy is the part of the internal energy of an equilibrated thermodynamic system that is proportional to its absolute temperature and increases or decreases by energy transfer.

In this way, we can ensure that the thermal energy of the cup-cafe system is lower than that of the jug-cafe system.

Have a nice day!

You might be interested in
In just thomsons experiments with electricity he showed that an electrical current can be
katen-ka-za [31]
In Thomson's experiment, he showed that an electrical current can be made to flow from a positive site to a negative site.
6 0
3 years ago
Read 2 more answers
18. Which metal is capable of forming more than one cation? <br> Li<br> Ba<br> Al <br> Sn
maw [93]

Answer:

Li

Explanation:

3 0
3 years ago
Hewo fellow earthlings
kobusy [5.1K]

Answer:

Hello!

Explanation:

5 0
2 years ago
Read 2 more answers
The pOH of a solution is 9.21. Calculate the hydrogen ion concentration of the solution. Be sure to report your answer to the co
11Alexandr11 [23.1K]

Answer:

[OH-] = 6.17 *10^-10

Explanation:

Step 1: Data given

pOH = 9.21

Step 2: Calculate [OH-]

pOH = -log [OH-] = 9.21

[OH-] = 10^-9.21

[OH-] = 6.17 *10^-10

Step 3: Check if it's correct

pOH + pH = 14

[H+]*[OH-] = 10^-14

pH = 14 - 9.21 = 4.79

[H+] = 10^-4.79

[H+] = 1.62 *10^-5

6.17 * 10^-10 * 1.62 * 10^-5 = 1* 10^-14

3 0
3 years ago
2. What is the mass of 5.33 x 10 moles of aluminum hydroxide?​
bearhunter [10]
<h3>Answer:</h3><h3>1865.5g</h3><h3>Explanation:</h3><h3 /><h2> first the chemical formular for ammonium hydroxide is NH4OH</h2><h3>its molarmass is given as N=14H=1O=16 </h3><h3> so we have 14 +1(2) +16+1 =35</h3><h2>also no of moles = mass / molarmass</h2><h3> we have 5.33×10 = mass/35 </h3><h2>therefore mass = 35 ×5.33×10 = 1865.5g</h2>
8 0
2 years ago
Other questions:
  • What is H20 and oxygen
    13·2 answers
  • Put the following names in the correct alphabetic indexing order:(1) Topper &amp; Casey Plumbing(2) KST Enterprises(3) Leland an
    12·2 answers
  • What does chlorine (Cl-) do for sodium (Na+)? What tasty substance is produced when this
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • PLEASE HELP!!!!!!!!!
    10·1 answer
  • Which lists the elements in order from most conductive to least conductive?
    14·2 answers
  • What do small numbers of 12,22, and 11 stands for in C12H22O11​
    14·1 answer
  • In 1676, Robert Plot discovered a large bone in a quarry in Cornwall, England. He observed that the bone looked similar to a hum
    5·1 answer
  • A single bond represents 4 electrons.<br> True<br> O False
    15·1 answer
  • Sodium chloride is composed of molecules that are stable when dry. In water, the atoms of the molecules separate from each other
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!