1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VARVARA [1.3K]
3 years ago
10

VERY EASY QUESTION. WILL MARK BRAINLIEST When is the peak hurricane season for the Atlantic Ocean Basin, and why do hurricanes p

eak during this time? August to October, because ocean temperatures are the warmest around the equator at that time August to October, because the atmosphere is the driest around the equator at that time September to December, because the atmosphere is the driest around the equator at that time September to December, because ocean temperatures are the warmest around the equator at that time
Biology
1 answer:
ololo11 [35]3 years ago
6 0

Explanation:

When is the peak hurricane season for the Atlantic Ocean Basin?

The official hurricane season for the Atlantic Ocean Basin is from 1 June to 30 November.

Why do hurricanes peak during this time?

Although the Atlantic hurricane season officially began on June 1st, a roughly eight-week period that is often the most active and dangerous time for tropical cyclone activity.

You might be interested in
What molecule is represented by the molecular model shown below?
ladessa [460]
Apparently it is ATP as deduced from the last line of text and no model to refer to.
8 0
2 years ago
I am a real "powerhouse" 
Bond [772]
Mitochondria is the powerhouse of the cell. Only thing I remember from middle school science
6 0
2 years ago
What is similar about sodium and potassium
Rama09 [41]
Both lie in 1st column of the Periodic Table. (contain the members of the Alkali Metals. Members within a family, column, or elements tend to have similar<span> chemical properties.</span>
8 0
3 years ago
Read 2 more answers
Distantly related organisms may be similar if they live in ?
liq [111]

Distantly related organisms may be similar if they live in Similar environments

3 0
3 years ago
What is the purpose of a fever?
juin [17]
When your body temperature rises because of an infection, it's called a fever<span>. </span>Fevers<span> are caused by chemicals called pyrogens flowing in the bloodstream. Pyrogens make their way to the hypothalamus in the brain, which is in charge of regulating body temperature.</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Prior to phytoremediation the concentration of Cd in the soil was: Prior to phytoremediation the concentration of Cd in the soil
    6·1 answer
  • 5. Membrane receptors are specialized proteins that take part in communication
    13·2 answers
  • What latitudes are most lightly to see glaciers
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Menstrual flow results in the discharge of select one:
    15·1 answer
  • Jerry listed the following processes in his notebook. 1. formation of dew on leaves 2. ice cubes turning to water 3. water drops
    12·1 answer
  • Suppose a female child is affected by hemophilia (xhxh). Determine the likelihood that her father was also affected
    11·1 answer
  •  Explain the difference in the structure of plant and animal cells<br><br><br><br> please No links
    13·1 answer
  • Name the three particles atoms are made up of.
    14·2 answers
  • What does that mean and how can our skin color be so varied?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!