1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
3 years ago
10

Which product is the result of light reactants in photosythesis

Biology
1 answer:
slega [8]3 years ago
8 0

The Light Reactions of Photosynthesis. Light is absorbed and the energy is used to drive electrons from water to generate NADPH and to drive protons across a membrane. These protons return through ATP synthase to make ATP.

<u>What is the end product of light reaction in photosynthesis?</u>

The energy from sunlight is converted into a small amount of ATP and an energy carrier called NADPH. Together with carbon dioxide, these are used to make glucose (sugar) through a process called the Calvin Cycle. This is the things happening during light reaction of photosynthesis .

Hope this helps:)

You might be interested in
HELP ME PLZ- I HATE SKOOL &gt;:((
hodyreva [135]
l hate school toooooooo:(
4 0
3 years ago
Read 2 more answers
Help needed thx btw.
xeze [42]
Which of the following amino acids can function as a neurotransmitter in the CNS?

1. Glutamic Acid it's because the vital inhibitory neurotransmitter in the CNS.

2. Huntington’s chorea has been linked with a deficiency in the amino acid ______.

Gaba  because its the chief inhibitory neurotransmitter in the mammalian central nervous system. 

3. Which of the following is not considered a monoamine?

Adenosine this has nothing to do with neurotransmitters that's linked to the heart.
7 0
3 years ago
1.True or false: Shakespeare followed the Elizabethan structure of a four-act play.
sashaice [31]

For one it is False


two is exhibition


I need terms to answer three

4 0
3 years ago
Read 2 more answers
Please help me on this Bio. question!
Ann [662]

The synthesis of new proteins

c

8 0
3 years ago
Read 2 more answers
Each part of the cell has a particular job to do. For example, a mitochondria's job is relaxing energy for cell use. Which pairi
nata0808 [166]

Answer:

D-Vacuole

Explanation:

The vacuole performs many functions such as storing water, nutrients,and wastes and it also plays a major role in the structure of the plant

3 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is reason for meiosis
    8·2 answers
  • How do I do this lab report assignment?
    13·1 answer
  • Human population growth has remained constant throughout human history. True or false
    14·1 answer
  • Rudolf Virchow's and Louis Pasteur's work resulted in significant contributions to cell theory but also . . contradicted earlier
    7·2 answers
  • Breaking carbohydrates into their subunits will yield ........ as products. Breaking down proteins will yield ........ as produc
    9·1 answer
  • Which level of organization in the classification system is directly above the family level? (5 points)
    6·1 answer
  • Temperature affect the rate of how enzymes work in a chemical reaction <br> A. True <br> B. False
    12·1 answer
  • How deep must wells be drilled in order to collect water?
    8·2 answers
  • OMG!!!! i need help asap please
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!