1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedbober [7]
2 years ago
14

Which of the answers indicate that you’re thinking like a scientist

Biology
1 answer:
BlackZzzverrR [31]2 years ago
7 0

Answer:

yes

Explanation:

You might be interested in
What is the phenotype of a plant with the genotype RR
vazorg [7]
To give a direct answer, I’d have to know what gene we were looking at. However, in a general sense, when a genotype has two capital letters, it means that it’s homozygous dominant. Take for example:

R= tall stalk
r= short stalk

The uppercase R is a dominant allele, which means if the plant has the gene with this in it (RR or Rr) then it will have that trait. If it has two lowercase letters (rr) then it will be the recessive trait.

Using this example, RR would be the tall stalk. For whatever your question is, the dominant phenotype would be the answer.
8 0
3 years ago
Read 2 more answers
HELP PLEASEE
atroni [7]
The answer is option D. The trees
6 0
3 years ago
Read 2 more answers
In John Watson's Little Albert experiment, the white rat was the ________ and the loud noise was the ________.
Korolek [52]

Answer:

In John Watson's Little Albert experiment, the white rat was stimulus associated specific entity and the loud noise was the associated stimulus.

7 0
3 years ago
Which of these are the two major sources of nitrate pollution in rivers? the burning of fossil fuels by factories and cars anima
snow_tiger [21]

Answer:

Animal Waste and Fertilizers

Explanation:

Animals, like humans, obtain nitrogen from consuming foods. The foods that the animals consume get digested and with time, the animals release the extra undigested foods and nutrients in forms of urine and feces. Like wise, fertilizers are typically made with animal waste.

6 0
2 years ago
The two lower leg bones are called the _____ and the _____.
Ad libitum [116K]
The two lower leg bones are called the tibia and the fibula
8 0
2 years ago
Read 2 more answers
Other questions:
  • X-rays _____.
    12·1 answer
  • How can knowledge of genetics be used to improve the agricultural production of food?
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How does simple diffusion differ from facilitated diffusion
    5·1 answer
  • the brown body colour of a drosophila fruit fly is dominant black body colour and is not sex linked explain how gregor mendel co
    14·1 answer
  • Rashad is studying for tomorrow's biology exam. He has been reading and taking notes for hours, and he feels like he cannot stud
    15·1 answer
  • In this food web, the ____________ is the primary consumer and a herbivore. a shrew b red fox c willow tree d snowshoe rabbit
    14·1 answer
  • Difference between spinal tap and epidural
    12·1 answer
  • Large molecules enter the cell by endocytosis and exit the cell by exocytosis. Structure “A” facilitates, or helps, the diffusio
    9·2 answers
  • 1 point
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!