1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
siniylev [52]
4 years ago
7

A client is diagnosed with a peptic ulcer. when teaching about peptic ulcers, the nurse instructs the client to report what kind

of stools? frothy ribbon shaped pale or clay colored dark brown or black
Biology
1 answer:
Sergio039 [100]4 years ago
8 0
<span>The person needs to report black stools that are tarry. These stools are an indication that there is bleeding. This occurs when digested blood gets in the stool. The stool will smell harshly. A person with a peptic ulcer must report this type of stool immediately.</span>
You might be interested in
Please help i will give brainlist
laiz [17]

Answer:

I think it's c hope I hope I helped if not I'm sorry:(

6 0
3 years ago
Read 2 more answers
3. Funaria is a bryophyte because
Romashka [77]

Answer:

funaria is a bryophy because of lack of xylem

6 0
4 years ago
What domains of organisms are prokaryotes, and what are the defining features of prokaryotes.
Burka [1]

Answer:

tagalog po ako hindi ako marong englis

6 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
What are organic molecules that catalyze reactions in living system
aksik [14]

Answer:

enzymes

Explanation:

Enzymes are organic molecules made up of proteins that catalyze reactions by either speed up or controlling the chemical reaction.

Enzymes are specific in the reactions they catalyze. An enzyme will only catalyze one specific reaction or a group of closely related reactions. For enzymes to catalyze a reaction, the substrate must fit in the active site on the surface of the enzyme. This forms an enzyme-substrate complex. The enzyme speeds up the formation of the products.

8 0
3 years ago
Other questions:
  • Pronghorn antelopes are hoofed animals that eat grasses and live in large herds in the prairie
    7·1 answer
  • In some cases of head injuries, the cerebrum may be affected. This type of injury could cause a loss of ................... And
    9·2 answers
  • G6PD deficiency is an inherited condition in which the body doesn't have enough of the enzyme glucose-6-phosphate dehydrogenase,
    13·2 answers
  • How does the anatomy of the endocrine and integumentary systems correlate with the sense organs? What role does radiology and ut
    10·2 answers
  • Of the three primary germ layers, which is responsible for developing into nervous tissue?
    5·1 answer
  • Can someone explain shared dominance
    11·1 answer
  • Hydrogen bonds hold two strands of DNA together by forming between nitrogen bases. True or false? i say true need second opinion
    5·1 answer
  • Where does transcription take place in eukaryotic cells
    15·1 answer
  • Question 1 (2 points)
    12·2 answers
  • PSYCHOLOGY <br> Briefly describe the relationship between hormones, emotion, and external behavior
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!