1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
13

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair

Biology
1 answer:
Natalija [7]3 years ago
6 0
GACTCCGTAACGGTTAACC. CTGAGGCATTGCCAATTGG G- pairs with C. A- pairs with T. Unless it is mRNA then A pairs with U.
You might be interested in
Write an interview with a water molecule. Write a story describing one possible trip that a water molecule could take through th
Annette [7]
Hi! did you get your answer or no if not I have it if you are interested. Have a nice day! ;)
3 0
3 years ago
All the members of a species that live in an area make up​
igomit [66]

Answer:

Population

Explanation:

4 0
3 years ago
Please help me. I needed it for tomorrow
emmasim [6.3K]

Answer:

Trophic cascades are powerful indirect interactions that can control entire ecosystems. Trophic cascades occur when predators limit the density and/or behavior of their prey and thereby enhance survival of the next lower trophic level.

Explanation:

their u go

5 0
2 years ago
What is the speed of a jet plane that travels 1864 meters in 42 seconds
Fed [463]
Speed = distance ÷ time.
1864/42=44.38
3 0
3 years ago
A group of similar cells that are organized to do a specific job.
oksano4ka [1.4K]
How does the water needed to carry out photosynthesis get to leaves?


A. through chlorophyll molecules

B. through vascular bundles

C. through stomata

D. through mesophyll cells
4 0
3 years ago
Read 2 more answers
Other questions:
  • Atlantic halibut is a species of flatfish that uses gills to extract dissolved gases from water for cellular respiration. During
    8·2 answers
  • Which is the only species of hominid that still exists today?
    13·2 answers
  • During which stage of a cell cycle do the cromosomes replicate
    14·1 answer
  • Protists are often grouped according to whether they are plant-like, fungus-like, or________.
    8·2 answers
  • What is life and how are living things organized
    6·1 answer
  • Why is it important to<br> maintain exact chromosome number during asexual<br> reproduction.
    9·1 answer
  • Which two processes in the carbon cycle are also parts of oxygen cycle
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Can someone please compare and contrast the different types of distribution for populations of animals?
    7·1 answer
  • Explain why a person at 14,000 ft would weigh less than a person at sea level, 0 ft.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!