1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lana71 [14]
3 years ago
9

Can a person jump further on the moon or earth?

Biology
1 answer:
uranmaximum [27]3 years ago
8 0

Answer:

the moon because it has less gravity than the earth. so you would jump father on the moon

Explanation:

You might be interested in
Which terms is a process that is made up of two other term
faust18 [17]
It’s photosynthesis
6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
A Venus flytrap closes around a small insect. Which life characteristic does this illustrate? A. reproduction B. response to sti
Mnenie [13.5K]
The answer is B: Response to stimuli
what response to stimuli means is that the organism reacts to something around it
the venus flytrap wouldn't just randomly close for no reason
it had to sense the fly, and react by closing.

it's not permeability because permeability means allowing things to pass through like soaking up water
unless your teacher is referring to absorbing the nutrients of the dead fly after it's been killed
but I don't think that's what this question is about
:)
6 0
3 years ago
Which of the things listed below would help SLOW DOWN global warming? *
Alex73 [517]

Answer:

Adding LESS carbon to the atmosphere.

Removing carbon that's already in the atmosphere.

Explanation:

have a gud day

7 0
3 years ago
Read 2 more answers
If. by examining your family history and DNA, you could tell how long you would
ycow [4]

Answer:

i need points

Explanation:

points

8 0
3 years ago
Other questions:
  • Based on the cladogram, if moths undergo complete metamorphosis, we would MOST LIKELY infer that
    7·2 answers
  • The main reason why fish with lungs and gulp air are not grouped with ''Amphibians'' is because
    6·1 answer
  • The pH of water is<br> because it contains an equal amount of H' and OH ions.<br> O5<br> ооо
    10·1 answer
  • The Taj Mahal in India is made of pure white marble. It is slowly losing its white color because of pollutants from vehicles and
    15·2 answers
  • 1). Describe how a predator, a prey, and a scavenger differ from each other. Give an example of each.
    10·2 answers
  • The purpose of the menstrual cycle is to _____.
    11·2 answers
  • What two environmental factors influence the shape of proteins?
    6·1 answer
  • What happens during carbon fixation?
    6·1 answer
  • How was Dr. Martin Luther King , Jr. , an important force in creating a more just world ?
    5·1 answer
  • Which chemical equation shows the relationship between ADP and ATP
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!