1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena55 [62]
3 years ago
12

What is the ability to produce clean water?

Biology
1 answer:
Jobisdone [24]3 years ago
8 0

Answer:

the ability to produce clean water is an index of water quality based on six attributes

You might be interested in
Although DNA is made up of only four different bases, it can encode the information necessary to specify the workings of an enti
VLD [36.1K]

Answer:

Because DNA molecules are extremely long.

Explanation:

DNA molecule is made up of only four types of nucleotides that are adenine, guanine, cytosine, and thymine. These four types of nucleotide encode all the information necessary for the formation and working of the entire organism because each DNA strand is as long as 2 meter which contains millions of base pairs.

The four nucleotides are arranged in the DNA strand with many different combinations which results in the formation of codons sequence that contains all the information about the cell. This long DNA is compressed several times to fit in the nucleus.

7 0
3 years ago
Read 2 more answers
What is the pH of a 0.00125 M HCl solution?
timofeeve [1]

Answer:

pH=2.9

Explanation:

Hello,

In this case, the pH is computed by:

pH=-log([H^+])

Whereas the concentration of hydrogen ions equals the concentration of the acid for strong acids such as hydrochloric acid (HCl) due to its complete ionization in solution, which means that such concentration is 0.00125 M. Thus, the pH turns out:

pH=-log(0.00125)\\\\pH=2.9

Regards.

4 0
3 years ago
Help there are 3 questions brainliest will be awarded.
Aleks [24]
1.b
2.d
3.a
this is the answer to your qeustion.
4 0
3 years ago
Certain flightless beetles have wings that have no function. The wings are an example of which type of structure?
iVinArrow [24]

<span>The wings on the beetles are examples of vestigiality. Vestigiality is a structure with attributes that have apparently loss its ancestral function but stil present during evolution. It is a normal evolutionary process in the changing environment that does not pressure them to evolve.</span>

8 0
3 years ago
Explain why carbon dioxide is referred to as a greenhouse gas. ​
Marina86 [1]

Answer:

I found the answer click the pic

4 0
3 years ago
Other questions:
  • This is the term for the weather patterns that an area experiences over a long period of time?
    10·2 answers
  • Explain the concept of wave-particle duality?
    13·1 answer
  • An important contribution to the homeostasis of the body by the muscular system is ___
    7·1 answer
  • PLEASE ANSWERR!!
    12·1 answer
  • How does the human body grow and repair?
    5·1 answer
  • Which of the following characteristics of living things could be applied to an automatic door at a supermarket?
    8·1 answer
  • Answers please?????????
    7·1 answer
  • A species of frog slowly dies off because it cannot compete with the toads and lizards that share its ecosystem. This is an exam
    10·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Check the statements below that provide evidence for the endosymbiosis theory
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!