1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
3 years ago
14

How does mudstone turn into metamorphic rock?

Biology
2 answers:
Stella [2.4K]3 years ago
8 0

Answer:

Option (C)

Explanation:

Sedimentary rocks are formed due to the compaction and lithification sediments. For example, mudstone, sandstone, and shale.

Metamorphic rocks are those rocks that are formed when a sedimentary/igneous/other metamorphic rocks undergo changes in the pressure and the temperature conditions. Temperature and pressure are the main factors here. For example, slate, phyllite, schist, and gneiss.

Mudstone is a sedimentary rock that can convert into a fine-grained and foliated metamorphic rock called slate due to the increase in the temperature and pressure.

Hence, the correct answer is option (C).

Veseljchak [2.6K]3 years ago
7 0

C is the answer.

Metamorphic rocks is when a rock changes under time and lots of pressure.

Sedimentary is rocks made of sediment.

Igneous rocks are rocks that are made of magma.

Knowing this, C is closest to the definition of metamorphic rocks.

You might be interested in
Please help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Bad White [126]

Answer:

A AND D

Explanation:

GOT IT RIGHT

8 0
3 years ago
Read 2 more answers
Stream of water will bend toward a balloon that has been read on a sweater to generate static charge which property of water is
Brut [27]
The polarity of the water molecule
4 0
4 years ago
Black panthers eat other animals in their ecosystem, including deer, fish,
Serggg [28]

Answer:

Carnivore

Explanation:

All things listed is meat

7 0
3 years ago
Read 2 more answers
What body mass index is required to be classified as "obese"?
kupik [55]
•if your BMI is between 25 to 29.9 you are considered overweight.
•if it is 30 and over then you are considered obese.
5 0
3 years ago
How does wheel and axle work?​
Mekhanik [1.2K]

Answer:

The wheel and axle is a machine consisting of a wheel attached to a smaller axle so that these two parts rotate together in which a force is transferred from one to the other.

8 0
3 years ago
Other questions:
  • Before eating a meal, a client with obsessive-compulsive disorder must wash her hands for 14 minutes, comb her hair for 114 stro
    8·1 answer
  • Most of the insulin manufactured today is produced by
    5·1 answer
  • Osmosis can be defined as
    15·2 answers
  • I need help in science ASAP PLEASE
    15·1 answer
  • Spring tides are the lowest tides of the year.<br> True<br> False
    8·1 answer
  • What are the rungs of the dna ladder made of?
    9·1 answer
  • Which of the following does not happen when a cell divides?
    10·1 answer
  • Which of the following is NOT part of the cell theory?
    9·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Phagocytosis of microbes by macrophages is enhanced by I) the binding of antibodies to the surface of microbes II) antibody-medi
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!