1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
5

All the populations of organisms living close enough together for potential interaction make up __________.

Biology
2 answers:
rosijanka [135]3 years ago
7 0
All the populations of organisms living close enough together for potential interaction make up a community!
Harrizon [31]3 years ago
7 0

Answer:

Community

Explanation:

You might be interested in
The portion of the dna double helix requiring the least energy input to form the bond is the.
WARRIOR [948]
The answer is hydrogen bond between the complementary strands.
6 0
1 year ago
Arrange the objects from smallest to largest.
solniwko [45]

Answer:

Saturn, moon, Jupiter

Explanation:

because the moon is 2,158.8mi and Jupiter is 86,881mi and Saturn rings is 30 ft

4 0
2 years ago
.Cells use ATP as a source of energy to carry out various functions within the cell. In order for ATP to be useful, a chemical r
Paul [167]
The correct answer is A.
6 0
3 years ago
Read 2 more answers
By allowing nutrients to enter the cell and extracting energy from food, cells are able to maintain
Zina [86]
The answer would be proper strength since others do not make sense in detailed.
3 0
2 years ago
What is the cutest animal
nataly862011 [7]

Answer: A puppy

Explanation: it just is

5 0
3 years ago
Read 2 more answers
Other questions:
  • True or false, dr. jonas salk developed a vaccine for typhoid fever.
    13·2 answers
  • Glacial erosion creates a number of landscape features. A low point along an arête that acts as a pass between glacial valleys i
    5·2 answers
  • What is the part of the syringe that goes down called?
    8·1 answer
  • I don’t get what to do
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • PLEASE ANSWER!
    10·1 answer
  • Which one of the following interspecies relationships has a negative effect on the abundance of both species?
    12·1 answer
  • During which stage of a scientific investigation is data collected?
    8·2 answers
  • Please someone help me please
    13·1 answer
  • (ANSWERED)Suppose you seal a house plant in a transparent glass container. What about the scenario would lead to the plant's dea
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!