1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
5

Which means of particle transport is shown in Figure 7–4 above?

Biology
2 answers:
SOVA2 [1]3 years ago
5 0
<span>The correct answer is D. Active transport is the movement of a substance across a cell membrane against its concentration gradient (from low to high concentration instead of high to low, which is what naturally occurs as diffusion). </span>
sattari [20]3 years ago
4 0
The correct option is D.
When it comes to movement of particles in an out of cells, there are two basic types of transportation, these are passive and active transportation. The passive transportation of particles does not require  the use of energy while the active transport system requires the use of energy in the form of ATP. From the diagram given in the question, it can be seen that energy is involved in the process. Energy is mainly needed to move the particles against the concentration gradient since the inside of the cell is highly concentrated while the outside has low concentration. <span />
You might be interested in
What is the name of the groove that forms in the middle of a dividing plant cell
mrs_skeptik [129]

Plants have cell walls, so cytokinesis cannot go on with a cleavage furrow, but instead, a cell plate  forms across the cell in the location of the metaphase plate.

There is no distinct groove along the cell plate as the cell divides because of the rigid nature of the cell plate or new cell wall.

A plant cell divides differently from an animal cell which forms a clear cleavage furrow because it only has a flexible cell membrane and not a rigid cell wall like plants.

The cell plate in plant cells is formed by membrane bound vesicles which migrate to the center of the cell where the metaphase plate used to be and fuse together to form a cell plate.

4 0
2 years ago
What is the source of all energy in the pyramid in model 1?
Wittaler [7]
The source of all energy in the pyramid in model one is the hawk
8 0
2 years ago
Which of these is MOST LIKELY to contribute to the long-term instability of a local ecosystem? A) storms that uproot large trees
ipn [44]
The answer to your question is B- introduction of non-native animal species 
7 0
3 years ago
Read 2 more answers
Which two words mean nearly the same thing
nydimaria [60]
Choose and pick may be an example
5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Write a letter to the president. What are some things you want to tell him about the way everything is being handled in this cou
    6·1 answer
  • Water is less ________ at lower temperatures because hydrogen bonds are more _________ and bond to each of its neighbors.
    10·1 answer
  • A cardiac researcher is trying to determine if a pattern of very high blood cholesterol is genetic in a group of Pennsylvania Du
    7·1 answer
  • Suppose that a dominant allele (P) codes for a polka-dot tail and a recessive allele (p) codes for a solid colored tail. In addi
    6·1 answer
  • What happens to the sugars that are made during photosynthesis? Choose the correct answer.
    12·1 answer
  • In which generation will there be almost 100% non-singing females if there are no changes in the birds’ environment and interact
    5·1 answer
  • Can someone please answer this correctly. Will give brainliest for right answer....​
    5·1 answer
  • Olivia says global warming can't be real because a blizzard in her town last winter lasted four days. How would you explain to O
    15·1 answer
  • How do organisms contribute to the carbon cycle?
    13·1 answer
  • What is the volume of air that is inhaled and exhaled with each normal resting breath?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!