1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
13

On which feature is science based?

Biology
2 answers:
Nana76 [90]3 years ago
4 0
Science is based on the feature of "<span>detailed research with reliable sources" among many other things. It is crucial that the tests can be repeated with the same results. </span>
Vlad1618 [11]3 years ago
3 0

Correct answer: A). Detailed research with reliable sources

Science is a collection of systematic knowledge that is acquired through study and organizing gained knowledge in the form of testable interpretation and prognostication about the universe.

The science tries to relate the knowledge to the facts that follow objective laws and whose development need systematization and method.

Hence, the correct answer would be option A.



You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Complete the cycle for ice wedging.
nydimaria [60]
2 is B. Water freezes and 4 is the rock breaks.

7 0
3 years ago
Read 2 more answers
Match the structural formula to the chemical formula for this substance.
Ivahew [28]
Jensibwkue. Heberibekkowbebdir r
4 0
2 years ago
Read 2 more answers
An increase in herbivore populations in an ecosystem will soon lead to
Angelina_Jolie [31]
Increasing predator population
4 0
3 years ago
Read 2 more answers
Are neurons located only in our brains? And also, when we are in a coma, what happens to our neurons?
Kazeer [188]

the brain is the only place you wil find brain nurons and when a person is in a coma the brain is not running at a fast alert as it would if u where awake the brain is working at a really slow alert speed becuase u wont be able to jus shake and wake a person out of a coma becuase the brains nurons are working slow

7 0
3 years ago
Other questions:
  • How are ants so strong?
    5·1 answer
  • An alternative method for examining the effects of fatty acids on blood flow would be to measure changes in blood pressure. If b
    13·1 answer
  • What is the most common bacterial sexually transmitted infection, which left untreated can lead to pelvic pain, pelvic inflammat
    13·2 answers
  • Nutrients which an animal can synthesize for growth and maintenance are in a category called
    6·2 answers
  • Smart growth is an urban planning theory that promotes the development of suburbs surrounding major city centers.
    10·1 answer
  • Yes that was correct.
    6·1 answer
  • What are kidney stones? How do they form?
    8·2 answers
  • PLEASE HELP!!!!!!
    12·1 answer
  • HELP I NEED HELP ASAP
    9·1 answer
  • On Venus, the sun appears to rise in the west and set in the east because the planet
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!