1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgesh-ka [11]
3 years ago
12

According to all known laws of aviation, there is no way a bee should be able to fly. Its wings are too small to get its fat lit

tle body off the ground. The bee, of course, flies anyway because bees don't care what humans think is impossible. Yellow, black. Yellow, black. Yellow, black. Yellow, black. Ooh, black and yellow! Let's shake it up a little. Barry! Breakfast is ready! Ooming! Hang on a second. Hello? - ###### # ##### - Oan you believe this is happening? - I can't. I'll pick you up. Looking sharp.
Biology
1 answer:
liraira [26]3 years ago
4 0
Because the bee doesn't care what humans think and flys anyways<span />
You might be interested in
When inhaled, crystalline silica can cause scar tissue to form on what organs?
Ghella [55]
Crystalline silica is a natural compound in the earth's crust and is a basic component of sand and granite. Silicosis is an incurable disease of the lungs caused by breathing crystalline silica dust. This dust can cause scar tissue to form in the lungs.                    
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which statement best describes the orbit of Earth?
ruslelena [56]

Answer:

B. Earth rotates on its own axis and revolves around the Sun.

Explanation:

The earth moves not only in one way but in two ways. It revolves around its axis and revolves around the Sun.

We do not notice it because we are on Earth and we turn together with it.

When the Earth revolves around its (imagined) axis, we call such a movement a rotation, and when it revolves around the Sun - a revolution.

8 0
2 years ago
Proceed through meiosis to anaphase I. Which chromosomes went up and which went down? Up: Down:
fomenos

Answer:

Lg and dp went up and dg and lp went down

Explanation:

3 0
2 years ago
What is the best source of vitamin C?<br> - Cheddar Cheese<br> -strawberries<br> -lentils
seraphim [82]
<span>-strawberries i hope dis helps you</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Pollution resulting from an oil spill is categorized as point source pollution. true or false?
    14·1 answer
  • Is hunightons disease caused by a dominant or recessive trait?
    11·1 answer
  • House sparrows from England were released in the United States. They have competed with native bluebirds. These house sparrows a
    9·1 answer
  • The Taj Mahal in India is made of pure white marble. It is slowly losing its white color because of pollutants from vehicles and
    8·2 answers
  • What is shown in the image?
    12·2 answers
  • Who is clinically dead? Group of answer choices A.John, who is not responsive to pain Naomi, B. who is not breathing and whose h
    15·2 answers
  • What effect can an ocean have on the climate?
    10·2 answers
  • What do pathogens that cause cancer include?
    11·1 answer
  • A student is investigating how substrate concentration affects the rate of anenzyme-catalyzed reaction. Which ​threevariables​ s
    5·1 answer
  • Conduct an investigation to provide evidence that living things are
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!