1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
6

What do complement proteins do

Biology
1 answer:
mash [69]3 years ago
3 0

Answer:

complement is a system of plasma protiens that can be activated directly by pathogens

You might be interested in
Explain <br> "I don't need to know everything; I just need to know where to find it, when I need it.
son4ous [18]
When referring to knowing where to find something when you need it you mean that you do not need a memorization of all things, you just need a source to find it when in need. I hope this answer suited your needs.
7 0
3 years ago
The organelle responsible for receiving, packaging, and shipping proteins is called the
zmey [24]
It is c your answer for your questions





3 0
3 years ago
Read 2 more answers
Human embryos have tails, which become tail bones before birth. Tails also appear in fish, reptiles, amphibians, birds, and mamm
lana [24]

Answer: a close evolutionary connection between humans and many other mammals

Explanation:

8 0
2 years ago
HELP PLS
son4ous [18]

Answer:

ask siri 123

Explanation:

i can help

4 0
3 years ago
A photograph of all the stained, prepared chromosomes in a eukaryotic cell is referred to as a:
kirza4 [7]
A photograph of all the stained, prepared chromosomes in a eukaryotic cell is referred to as a karyotype
7 0
3 years ago
Other questions:
  • An atom of the element ____________has an average atomic mass of about 16 amu.
    12·2 answers
  • Disruptive selection favors which phenotypic traits?
    6·1 answer
  • Which autonomic nerve innervates the urinary bladder, uterus, and external genitalia?
    11·2 answers
  • Chemical reactions in cells are faster than the same reactions outside cells. True or false?
    7·1 answer
  • What is the cell type in archaebacteria kingdom? prokaryotic or eukaryotic?
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Aerobic exercise increases the body's consumption of which of these?
    5·1 answer
  • Orgasms whose DNA is contained within a nucleus are called
    5·2 answers
  • Proteins carbohydrates and lipids are examples of biological ____
    15·1 answer
  • Please answer my question correctly​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!