1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
brilliants [131]
3 years ago
13

What regulates the enzymes present in an organism? A. phenotype B. genotype C. proteins D.carbohydrates

Biology
2 answers:
Sveta_85 [38]3 years ago
6 0
The correct answer is B.
Tpy6a [65]3 years ago
5 0
I believe it is B. Genotype
You might be interested in
True or false?? the extinction of a species affects other species, including humans. explain your answer..
Sonbull [250]
I'm thinking true heres why lets say you have a bird and the bird eats worms.. and all the worms in the world are gone the bird will die and what ever animal ate that bird will die and what ever animal ate that bird will die and so on 

my guess
4 0
3 years ago
Read 2 more answers
Question 2 of 10
pentagon [3]
D bc active transport is basically the opposite of osmosis and diffusion
3 0
1 year ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
give an example of what the failure on an organ have on other organ systems? pls write your answer short! Thanks in advance!
devlian [24]
Hey this is late, but if an organ fails, like for example the kidney fails right? So then it affects the heart. and so on, because the kidney helps clean the blood and your body needs blood.
8 0
3 years ago
Which one of the following is an example of the chemical modification of an active pharmaceutical ingredient? Group of answer ch
Alexeev081 [22]

Answer: Combining a basic API with citric acid to produce the citrate salt of the API.

Explanation:

Chemical modifications refers to the processes that involve changes in the general composition of drugs to produce another entity with different chemical properties.

From the answer, Basic API combine with citric acid to produce the citrate salt of API which have different chemical properties from the reactants.

8 0
3 years ago
Other questions:
  • Which structure is found in the cytoplasm of a prokaryotic cell
    11·1 answer
  • Ow does the zygosporangium of Rhizopus stolonifer function to ensure the survival of the species?
    12·1 answer
  • In a comparison of birds and mammals, the condition of having four limbs is _________.
    10·1 answer
  • The innermost meninx that protects the brain and spinal cord is the _________.
    8·1 answer
  • when different parts of an organism work together in unison things can be accomlished that could not happen otherwise explain th
    8·1 answer
  • Cell A has half as much DNA as cells B, C, and D in a mitotically active tissue. Cell A is most likely in
    7·2 answers
  • What occurs when sediment reaches its final destination. A. Erosion B. Deposition C. Weathering D. Transportation
    5·2 answers
  • In what ways are producers and consumers alike?
    11·2 answers
  • CAN I GET ANSWER OF 2 AND 4​
    15·1 answer
  • Helpppp meeeeeee..............................
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!