1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
10

Fitz loves growing flowers for his mom and friends. Her favorite flowers, roses, are red roses(RR), blue roses (R’R’), and purpl

e roses (RR’). What type of inheritance pattern is this? What would happen if Fitz crossed a blue rose with a purple rose?
Biology
1 answer:
natali 33 [55]3 years ago
5 0

Answer:

They would Mix?

Explanation:

This is a really good question if they don't mix then i guess they'd have 50% chance of being blue and 50% chance of it being purple

       R         R       P  U  R  P  L  E

     _________

R  | RR    |  RR   |

     _________

R  |  RR   |  RR   |

    _________

B

L

U

E

You might be interested in
What is the primary function of lipids
Lelu [443]

Answer:

The functions of lipids include storing energy, signaling, and acting as structural components of cell membranes. Lipids have applications in the cosmetic and food industries as well as in nanotechnology.

Explanation:

8 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which reaction is responsible for the production of lipids when glycerol is joined to three fatty acids?
Anna35 [415]

This reaction is called a condensation reaction. It is also known as  a dehydration reaction.

When three fatty acids become attached to a glycerol molecule, a triglyceride is formed.  The fatty acids become attached to the glycerol through a condensation reaction named so because 3 water molecules are formed from the 3 OH groups from the fatty acid chains and 3 H atoms from the glycerol.

The bond formed between the fatty acid chain and the glycerol is called an ester linkage.



4 0
3 years ago
PLZ HELP <br>Identify the process that orginsims use to grow and replace old or damaged cells
RUDIKE [14]
The process cells use to grow and replace old cells is mitosis.
4 0
3 years ago
The lowest level of environmental complexity that includes both living and nonliving factors is the
Stells [14]

The lowest level of environmental complexity that includes living and nonliving factors is the

C: Ecosystem


5 0
3 years ago
Read 2 more answers
Other questions:
  • Cortisone is a steroid that is applied to the skin to reduce inflammation. Cortisone acts on cells within the dermis and can tra
    8·1 answer
  • Why do plants need sunlight?
    8·1 answer
  • Female starlings (a species of bird) that lay clutches of four or five eggs have more surviving young than those with either lar
    10·1 answer
  • 1. The tropopause is
    8·1 answer
  • If scientists find something they think is living on mars or Venus how will they know it is actually living
    11·2 answers
  • What letter represents mRNA
    14·1 answer
  • We use genetically modifed animals for protein tracking as well as novelty pets.
    15·1 answer
  • All of the following are functions of proteins except?
    10·2 answers
  • Help me with Wave stuff lol
    12·1 answer
  • When water changes state from a gas to a liquid, the ____________ of the water remains the same.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!