1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
10

The circumference of a circle is 106.81 yards. Finds the diameter of the circle to the nearest tenth

Mathematics
1 answer:
Viefleur [7K]3 years ago
8 0

Answer:

this answer is attached to the picture

You might be interested in
• What is the solution to 5x+ 20 = 7(x+2)?
o-na [289]

For this case we must find the solution of the following equation:

5x + 20 = 7 (x + 2)

Applying distributive property on the right side of the equation we have:

5x + 20 = 7x + 14

Subtracting 7x from both sides of the equation:

5x-7x + 20 = 14\\-2x + 20 = 14

Subtracting 20 from both sides of the equation:

-2x = 14-20

Different signs are subtracted and the major sign is placed.

-2x = -6

Dividing between -2 on both sides of the equation:

x = \frac {-6} {- 2}\\x = 3

Thus, the solution of the equation isx = 3

Answer:

x = 3

6 0
3 years ago
What is the equation for shifting the standard sine curve 2 units horizontally?
ratelena [41]
     Just add the displacement value to variable. If this value is positive, the graph will move to the right, otherwise it will shift to left.

f(\O)=sen(\O+x)
 
     Where: x=displacement value

If you notice any mistake in my English, please let me know, because I am not native.
3 0
3 years ago
Which problem is equivalent to 12/18
Olenka [21]

Answer:

B

Step-by-step explanation:

5 0
3 years ago
What percent of 56 is 42?
svetoff [14.1K]

Answer:

nicki monaj is the queen of rap

Step-by-step explanation:

periodt purr

8 0
3 years ago
Read 2 more answers
A pair of shoes weighs 650 grams.How many decigrams does it weigh?
Scorpion4ik [409]
We know that 1 gram = 10 decigrams

That means that 650 * 10= 6500

Hope this helps!
6 0
3 years ago
Read 2 more answers
Other questions:
  • Karla has spent $42 on food she bought milk, cheese, and meat. The milk cost half as much as the cheese and the meat cost four t
    12·1 answer
  • Please can u answer these for me
    15·1 answer
  • Simplify.12-16/(-4) A.8 B.-1 C.16 D.1
    6·1 answer
  • OMG HELP A GIRL OUT !!HELP ME PLEASE I NEED A 70%
    14·2 answers
  • I’ll give 17 points for this!
    9·2 answers
  • If a number is a natural number it is a complex number
    12·1 answer
  • Write the expression in factored form 100m^2-121
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the solution to the given system of equations?​
    10·1 answer
  • Pls answer i will fail:-}
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!