Answer:
The electron transport chain may be defined as the sequential steps of the oxidation and reduction of the cytochromes. The electron transport chain is important for the production of ATP.
The gramicidn protein is an ionophoric antibiotic that can affect the electron transport system. The electron transport rate, oxygen uptake and proton pumping remains the same as more hydrogen ions will enter in the cell. But the ATP synthesis rate might decrease and completely stop by using gramicidin.
<u>Answer:</u>
"Rainwater pouring from an eroded bank into a river" is a non-point source of water pollution.
<u>Explanation:</u>
Bank erosion is the washing away of stream or river banks. This is distinct from erosion of the watercourse bed, known as scour. These erosion undermines the roots of trees which develop by a lake. As the roots closely connect the soil, they form abutments that jut out above the surface.
Non-point source water contamination is induced by widespread and isolated waste sources such as rain and snowmelt runoff, spills, leaks, and sediment erosions. To release any pollutant, without a permit, from a point source into navigable waters is illegal according to the Clean Water Act.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
C. cell- tissue- organ- organ- system
