1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
11

Which of the following proteins attach desmosomes to one another?

Biology
1 answer:
Naya [18.7K]3 years ago
6 0
A. Catherine
Correction is cadherins
You might be interested in
If it is 12:30pm friday in shanghai china, what time and day is it in bangkok
prisoha [69]
It will be 11:30 AM in bangkok, or so the time zone says..... lol
7 0
3 years ago
In anatomical, directional terminology, the esophagus is _________ to the mouth.a.Superiorb.Lateralc.Mediald.Posterior
Margaret [11]

Answer:

In anatomical directional terminology, the esophagus is <u>posterior</u> to the mouth (option d).

Explanation:

The esophagus is a tubular organ that is part of the digestive system and its function is to carry food from the mouth to the stomach. The anatomical relationship of the proximal end of the esophagus, with respect to the mouth, is posterior and inferior, its distal end also being located above the stomach.

This anatomical relationship allows the direction of food movement to be mouth → esophagus → stomach.

4 0
3 years ago
Plants, such as sunflowers, contain specialized receptor cells that respond to light and grow in the direction of a light source
loris [4]
Photoreceptor proteins are light-sensitive proteins involved in the sensing and response to light in a variety of organisms. Some examples are rhodopsin in the photoreceptor cells of the vertebrate retina,phytochrome in plants, and bacteriorhodopsin<span> and bacteriophytochromes in some bacteria.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
5 0
3 years ago
Approximately how quickly do the Earth's crustal plates move? A. A few centimeters a year B. A few centimeters a month C. A few
aliya0001 [1]

The correct answer is - A. A few centimeters a year.

Earth's crustal plates move very slowly, between 2 cm and 5 cm (depending on the plate) annually. This is the reason why it takes millions of years for them to significantly change their position, and with it the appearance of our planet. These crustal plates are slowly moving around the planet because they are powered by flow in the interior mantle.

6 0
3 years ago
Explain the connection between the beginning of life and the universal genetic code
GaryK [48]

The connection between the beginning of life and the universal genetic code is that they all started with a simple one celled molecule. The Universal genetic code is a common language for almost all organisms to translate nucleotide sequence of deoxyribonucleic acid that is DNA and ribonucleic acid that is RNA to amino acid sequences of proteins. All living Organisms have a genetic code generally represented by the sequence of nucleotides in their DNA.

8 0
3 years ago
Other questions:
  • Ascidians are sac-like marine organisms. Their larvae have well-developed brains and dorsal nerve cords. This suggests that asci
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • It is possible to determine a person's exact date of birth from their bones.
    15·2 answers
  • Vitamins b ___ and b _____ are involved in protein synthesis.
    15·1 answer
  • one parent is homozygous cleft chin and the other is heterozygous. MAKE A PUNNET SQUARE to show the propability in their offspri
    10·1 answer
  • Determine the genotypes of the parents if the father is blood type A the mother is blood type B the daughter is blood type O one
    13·1 answer
  • ___________ from the sun is thought to have a been a driving force behind the beginnings of life and creation of the atmosphere
    5·2 answers
  • What is the purpose of mitotic cell division in multicellular organisms (give all 3 purposes)? Compare this to the purpose of mi
    11·1 answer
  • What might a clinician see in a karyotype showing a genetic disorder?
    7·1 answer
  • 1. Why would it be important to consider island biogeography if you are managing a reserve for an endangered species?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!