1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
2 years ago
13

a type of pollution in which the source of the pollution is not easily identifiable is called pollution

Biology
1 answer:
ratelena [41]2 years ago
3 0

Answer : Non point source pollution.

Explanation

Pollution that does not originate from a single source, or point, is called nonpoint-source pollution.

You might be interested in
Which list shows three components of an organ system in order of least complex to most complex?
kolbaska11 [484]

Answer:

I believe its muscle cell, muscle tissue, stomach

Explanation:

The order for organ systems from least complex to most complex is: Cell, tissue, organ, organ system. Hope this helps

7 0
3 years ago
Read 2 more answers
Class Agatha have a common name that stems from their key characteristics. what is the common name?
astra-53 [7]
Jawless fish. The class Agnatha is a class made up of jawless fish. It excludes all vertebrates with jaws.
5 0
3 years ago
to understand the levels of biological organization, match each of the labels with the correct illustration. Place your cursor o
rewona [7]

Answer:

organelle- part of a cell (example- mitochondrion)

cell- basic unit of structure  (example- muscle cell)

tissue- group of some cells  (example-muscle tissue )

organ- one or more types of tissue (example- stomach)

organ system- group of organs working together (example- digestive system )

Organism- individual living thing (example- goat )

Explanation:

Organization of living things! Hope this helps.

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
How does soil quality affect the characteristics of ecosystems?
Alexus [3.1K]
The answer is. Soils play an important role in all of our natural ecological cycles—carbon, nitrogen, oxygen, water and nutrient.A handful of soil can contain billions of different organisms that play a critical role in soil quality to support plant growth.
4 0
3 years ago
Other questions:
  • Humans cannot convert the sun's energy into glucose for themselves because humans lack _____. leaveschlorophyllvacuolesflowers
    10·2 answers
  • What do astronomers use too calculate the age of the universe?check all dat apply?
    15·2 answers
  • Which statement best defines the relationship between work and energy?
    14·2 answers
  • If you can help please
    14·1 answer
  • I have the biology STAAR test tomorrow what facts and tips would help me pass it please help
    9·1 answer
  • Help brainliest involved!!:)
    10·2 answers
  • CaF2 + H 2 SO4<br>CaSO 4 + 2HF que reacción química es<br>​
    10·1 answer
  • Would he be considered a white or indigenous Hispanic?
    6·2 answers
  • Could someone pls help me with this question?
    6·2 answers
  • What is the largest body on nine planets
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!