1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
3 years ago
11

During photosynthesis, plants take in carbon dioxide, water, and energy from the sun and produce carbohydrates and oxygen. Which

of the following statements best explains how plants follow the law of conservation of mass during photosynthesis?
The amount of each element in the reactants equals the amount of each element in the products.

The number of carbon dioxide molecules taken in exactly equals the number of carbohydrate molecules produced.

The plant uses the carbon dioxide gas, liquid water, and energy to produce a solid carbohydrate.

The plants mass does not increase or decrease as a result of photosynthesis.
Biology
1 answer:
zzz [600]3 years ago
6 0
The amount of each element in the reactants equals the amount of each element in the products is the correct one. Could u Mark me brainliest and thnx
You might be interested in
What are two types of evidence that evolution has taken place?
lukranit [14]
An example i can think of is...

the amount of salt present in human cells cytoplasm suggests we evolved from species in the sea
5 0
3 years ago
What are the 5 spheres that make up the earth?
Leto [7]

Atmosphere.

Hydrosphere.

Biosphere.

Cryosphere.

Lithosphere(also referred to as the Geosphere).

7 0
3 years ago
Read 2 more answers
Which level of biological classification do Mammalia and Hominidae represent, respectively?
cupoosta [38]
The answer is class and family.

<span>Taxonomic groups are used for biological classification. There are eight main taxonomic groups: domain, kingdom, phylum, class, order, family, genus and species, with the domain as the most inclusive and species as the least inclusive. If we take a look on Mammalia and Hominidae classification, we can assume that Mammalia represents class, and Hominidae represents family:</span>

<span>1. Domain: Eukarya</span>

<span>2. Kingdom: Animalia</span>

<span>3. Phylum: Chordata</span>

<span><u>4. Class: Mammalia</u></span>

<span>5. Order: Primates</span>

<span><u>6. Family: Hominidae</u></span>

<span>7. Genus: Homo</span>

<span>8. Species: Homo sapiens</span>

3 0
3 years ago
if a microscope has a eyepiece lens with a power of 25X and an objective lens with a power of 50X, what is the microscope's tota
Lyrx [107]

Answer:

1250

Explanation:

7 0
2 years ago
What are some fun facts about seamounts?
I am Lyosha [343]

* There have been times when naval vessels have collided with uncharted seamounts

* Seamounts can grow large enough to become an oceanic island

* Seamounts are usually in archipelagos, or groups of  seamounts or island  surrounded by a body of water

                                    (: I hope this helps! :)


3 0
2 years ago
Other questions:
  • Table salt is a compound that is made from an equal number of chlorine atoms and sodium atoms bonded together. Which of the foll
    15·2 answers
  • Fish eat algae, which are organisms that make their own food. Which two types of organisms are present in this scenario? consume
    14·1 answer
  • Why can't you go to a garden store and buy fern seeds?
    10·2 answers
  • plants and ____ formed a mutualistic relationship in the form of mycorrhizae and were the first multicellular organism on land
    5·2 answers
  • Human height tends to follow a normal distribution. For example, 80 percent of men are somewhere between 5 feet 4 inches tall an
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Socialization only happens within the family?<br> true<br> false
    13·1 answer
  • Describe Photosynthesis including where it occurs, what happens, and what types of organisms use it.
    10·1 answer
  • SELECT ALL ANSWERS THAT APPLY- Which of the following are examples of negative feedback?
    5·1 answer
  • 22. Discuss the differences between monogamous and serial monogamous relationships and potential implications for contracting ST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!