1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
2 years ago
10

Write Fe salts (divalent Fe)?​Pleasee help.... I will mark the answer with brainlist.

Chemistry
1 answer:
kakasveta [241]2 years ago
5 0

Answer:

Graphitic carbon nitride (g-C3N4) is a rising two-dimensional material possessing intrinsic semiconducting property with unique geometric configuration featuring superimposed heterocyclic sp2 carbon and nitrogen network, nonplanar layer chain structure, and alternating buckling. The inherent porous structure of heptazine-based g-C3N4 features electron-rich sp2 nitrogen, which can be exploited as a stable transition metal coordination site. Multiple metal-functionalized g-C3N4 systems have been reported for versatile applications, but local coordination as well as its electronic structure variation upon incoming metal species is not well understood. Here we present detailed bond coordination of divalent iron (Fe2+) through micropore sites of graphitic carbon nitride and provide both experimental and computational evidence supporting the aforementioned proposition.

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
How many molecules are in 120 grams of Na2SO4
brilliants [131]

3.06 × 10^23 molecules

5 0
3 years ago
What is the name of the salt with the structure K2S
gavmur [86]
Potassium sulphide :)
6 0
3 years ago
Which law is based on the graph that is shown below?
Cerrena [4.2K]

Answer:

Boyle's Law

Explanation:

8 0
3 years ago
What is the range for the following set of scores? Scores:6, 12, 9, 17, 11, 4, 14
MrRissso [65]
This is the answer is 17
5 0
3 years ago
Other questions:
  • What is the pH of a 0.001M HNO3 solution
    10·1 answer
  • Covalent solutes are considered non-electrolytes. What does this mean for the conductivity of the solution?
    14·2 answers
  • How is the sun involved in a food web?<br>​
    15·2 answers
  • Why are some lava's viscous than other's?
    8·1 answer
  • Which of the following solutions can be used to neutralize HNO3?
    14·1 answer
  • What is the concentration (m) of ch3oh in a solution prepared by dissolving 12.9 g of ch3oh in sufficient water to give exactly
    10·1 answer
  • What is the name of the second halogen ​
    6·1 answer
  • 1. Why are the world’s rainforests so important?
    8·1 answer
  • Sticky question: how do you separate molecules that are attracted to one another?.
    7·1 answer
  • Select the correct answer.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!