1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lyudmila [28]
3 years ago
9

S the human population grows, what happens to our natural-resource requirements?

Biology
1 answer:
Salsk061 [2.6K]3 years ago
6 0

Answer:

They decrease because there would be like a competition, everyone trying to survive by getting these natural resources

You might be interested in
What is the formula for photosynthesis
solniwko [45]

Answer:

6CO2 + 6H2O → C6H12O6 + 6O2

Explanation:

;)

4 0
3 years ago
Which does not likely occur in the surrounding area during the breakdown of ATP? A. Released energy activates an enzyme B. An en
Fynjy0 [20]
<span> During the breakdown of ATP, ADP moving back to ATP synthase will most likely not happen.</span>
7 0
4 years ago
Which of the following characteristics of a watershed would act to reduce erosion
pochemuha
Soil with high porosity<span>
</span>
6 0
3 years ago
In a certain breed of dogs, black hair is dominant and brown hair is recessive. If two parents are heterozygous for black hair,
Morgarella [4.7K]
I think it maybe 75% because both parents can give the dog black hair
7 0
3 years ago
Approximately 60 percent of the earth’s surface is covered with the global oceans. true false
Black_prince [1.1K]
Thats question is a true question 
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is a behavior in mating in which one male breeds with a female for a certain period of time and then finds a different mate
    8·1 answer
  • What is the enzyme that breaks down starches called
    8·1 answer
  • A blister is an example of what type of skin eruption? crust
    10·1 answer
  • A inhibitor of carbonic anhydrase would: a) interfere with oxygen binding to hemoglobin. b) increase blood pH. c) increase the a
    5·1 answer
  • How is decomposers important to the health of an ecosystem?
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • What are 5 animals that are related to horses.<br> what are 5 animals that aren't
    7·1 answer
  • Scientists want to perform an experiment to see if poison ivy grows taller when exposed to more carbon dioxide. How should the c
    6·1 answer
  • Which feature separates watersheds?<br> basins<br> bays<br> ridges<br> rivers
    5·2 answers
  • Describe the process in the mantle that causes plates to move. In your response, provide the force driving this process and at l
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!