Please help!!!! I don’t have time. The question is in the picture

Biology

1 answer:

Kruka [31]3 years ago

6 0

They posses the following traits: vertebrae, bony skeleton, four limbs, and amniotic eggs

Phylogenetic trees present common traits to animals in similar phylums.

These trees characterize traits by having the animal ABOVE the trait. Take these few examples from here: primates and rodents and rabbits are the ONLY ones with hair and crocodiles and birds are the ONLY ones with eggs with shells.

Now that you know this, look at the 4 types of animals that must have the similar traits. Look for the characteristics that are below them. They are all above the following: vertebrae, bony skeleton, four limbs, and amniotic eggs. These are the traits that all the organisms similarly have.

For a better understanding, any animals BELOW the traits do NOT have the traits, take for example that sharks and ray-finned fish are below four limbs, meaning they don’t not possess this trait.

You might be interested in

The first part of photosynthesis within the chloroplast occurs in the______and the second in the _____of the chloroplast

Kazeer [188]

The first part of photosynthesis within the chloroplast occurs in the GRANA and the second in the STROMA of the chloroplast

7 0

4 years ago

Science is best describe as

sattari [20]

Carrying out experiments to prove a point and to further knowledge about the world around us and the galaxy we live in

8 0

3 years ago

What is An example of dehydration synthesis

nekit [7.7K]

Dehydration synthesis is the process of joining two molecules, or compounds, together following the removal of water. When you see the word dehydration, the first thing that may come to mind is 'losing water' or 'lacking water.' ... Dehydration synthesis is classified as a type of chemical reaction.

3 0

3 years ago

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0

3 years ago

What is NOT true about the evidence that fossils provide?

aleksandrvk [35]

Answer:

C. All fossils contain intact DNA that can be sequenced.

Explanation:

Fossils are the impression, trace or preserved remains of once-living thing from past thousands of years such as bones, exoskeletons, objects preserved in amber, and stone imprints of animals or microbes.

Fossils provide evidence about seevral characteristics and features of extinct organism such as evolutionary relationship between organisms and transitional forms between groups of organisms. but all the fossil do not provide evidence about the intact DNA that can be sequenced because some fossils carry DNA rumnants which do not have the ability to get sequenced.

Hence, the correct option is C.

6 0

3 years ago