In the coding region, natural selection tends to eliminate all of the mutations because of the high importance these regions have. The coding region contains genes that synthesize proteins and the changes in the DNA sequence can have devastating effects on the cell. Therefore, there are very few differences in the sequences of coding regions that can help us trace the lineage.
On the other hand, in the non-coding regions, the mutations often accumulate because they have little effect on the cell and the adaptive value of the organism. This enables us to trace up the lineage by comparing the sequences and seeing the differences in the sequences.
<span>Algae blooms are the consequence of large amounts of fertilizers in the water. Algae use the presence of increased nutrients and enhance their own growth. It is known that they produce an oxygen in the photosynthesis, so it is not a problem while they are still alive. But when these organisms die, their decomposition begins. For the process of decomposition, the oxygen is needed and ultimately it will be depleted from a body of water. This could lead to the death of aquatic animals that depend on oxygen. So, in the population will survive only those who are able deal with the lack of oxygen in the water</span>
the answer is the sympathetic nervous system i got that answer on my test
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
