1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
12

Jake is taking photos of his neighbor's home to help them list and sell the house. It is

Biology
1 answer:
katrin [286]3 years ago
5 0
The answer is Angles
You might be interested in
In your own words explain how you think that DNA, mutation, genotype, phenotype, and natural selection interconnect to cause evo
saw5 [17]

Answer: According to sources, the most probable answer to this query is that evolution happens because when life came it sought for survival. Now, this is through mutation which causes random DNA sequences leading to genotypic and phenotypic changes. Natural selection as relation to adapting to the selection forces of the environment. And when these factors is added by the niche and other large case scenario to cause major anatomical changes, speciation comes through. And that, the process of evolution. And how it is a mechanism and an intermediate interaction with the environment.  

Explanation:

6 0
2 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which of these Earth systems is most responsible for the increases in global warming?
Mnenie [13.5K]
The biosphere is most responsible fir the increases of global warming
8 0
3 years ago
Read 2 more answers
3. What instrument measures air pressure? What unit of measurement is used to measure air
diamong [38]

Answer:

Barometer (mb)

Explanation:

3 0
3 years ago
In addition to E. coli, a risk factor for development of pyelonephritis is: a. urinary retention and reflux. b. nephrotic syndro
monitta

Answer:

One of the factors for the development of pyelonephritis, in addition to E. coli, is urinary retention and reflux (option a).

Explanation:

Pyelonephritis is an infection of the upper urinary tract caused by bacteria in the urine, such as Escherichia coli.

Under normal conditions, urine in the urinary bladder is aseptic, that is, without bacteria.  The presence of bacteria in the urine indicates a urinary infection.

Urinary retention is the limitation of the expulsion of urine from the bladder. This promotes:

  • <em>An increase in the amount of bacteria present in the bladder. </em>
  • <em>The pressure generated by urine retention causes the bladder to generate a retrograde flow - reflow - towards the ureters, leading the bacteria to the kidneys. </em>

The result of urinary retention and reflux - when bacteria are present - is an infection in the upper urinary tract, called pyelonephritis.

Learn more:

Urinary tract infection brainly.com/question/4756206

5 0
3 years ago
Other questions:
  • What are the benefits of stationary weather collection? moving collection
    12·1 answer
  • Diabetes insipidus is a syndrome in which an underproduction of ________ exists.
    14·1 answer
  • Which one is different from this list: Lion, wolf, tiger, horse?
    8·2 answers
  • What organelle modifies new polypeptides and sorts proteins and lipids?​?
    5·1 answer
  • The reproduction of DNA during interphase begins with _____.
    8·2 answers
  • What types of emergency situations could rescue workers be in that would make it difficult for them to get the energy to their e
    12·1 answer
  • Bees may pick up pollen of one flowering species on a certain place on their bodies. If this area does not come into contact wit
    10·1 answer
  • Answer A or B
    15·1 answer
  • what is the relationship between peripheral resistance and blood pressure ? between blood viscosity and blood pressure
    15·1 answer
  • Scientists believe that there are three jeans what contribute to skin color in humans.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!