1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
2 years ago
13

2. Why is sunlight important to an aquatic biome?

Biology
1 answer:
vivado [14]2 years ago
7 0

Answer:

Sunlight, of course, is necessary for photosynthesis, which brings energy into an ecosystem. So, the availability of that sunlight has a direct impact on the productivity and biodiversity of aquatic ecosystems.

You might be interested in
Which sentences in this excerpt from Ernest Hemingway's "In Another Country" show that medals and awards in war don’t always bri
s2008m [1.1K]

The options attached to the above question are given below:

A) The boys at first were very polite about my medals and asked me what I had done to get them.

B) I showed them the papers which were written in very beautiful language of full of fratellanza and abnegazione but which really said with the adjectives removed that I had been given the medals because I was an American.

C) after that their manner change a little toward me although I was their friend against Outsiders

D) I was afraid but I was never really one of them after they had read the citation because it had been different with them and they had done very different things to get their medals.

E) I had been wounded it was true but we all knew being wounded after all was really an accident.

ANSWER

The correct option is D.

In the statement given in option D, it can be seen that the speaker was formerly a soldier, who had fought in a war and had been awarded a medal to that effect. But despite knowing about this meritorious service that he had rendered to his country and the award he was given, he was not really accepted as an inner person by the group of people that was refereed to in the statement. They did not think much of him.


5 0
3 years ago
Read 2 more answers
An instructor says that this disease has been nearly eradicated in developed countries. which disease is probably being discusse
lawyer [7]

Nowadays, different countries are constantly emerging and expanding their liabilities which may include the field of medicine. The disease that is being discussed by the instructor that is considered nearly eradicated is probably the measles. This disease is caused by Paramyxovirus which is a major respiratory pathogen among infants and young children. Measles is also known as “rubeola virus”, an acute, highly respiratory symptoms and a maculopapular rash that affects the mouth, head, body and extremities. It begins with the appearance of Koplik spots which may end up to some complications like symptomatic encephalitis and subacute sclerosing panencephalitis(SSPE). In order to prevent this type of disease MMR(Measles, Mumps & Rubella) Vaccine is needed. According to some of the reports, it is still common to some of the countries, but WHO campaigns to eradicate the disease worldwide by the year 2020.

6 0
3 years ago
What is AquAdvantage Salmon? What is its purpose?
Firdavs [7]

AquAdvantage salmon is a genetically modified Atlantic salmon to increase size, in which producing a larger yield of food and resources.

Hope this helps!

6 0
3 years ago
Correct answer gets brainly
katen-ka-za [31]

Answer:

where's the work?

Explanation:

7 0
3 years ago
What would we need to know to calculate both work and power
krok68 [10]

Answer:

t's force, distance, and time

Explanation:

The equation for Work = Force * Distance

The equation for Power = Work / Time = Force * Distance / Time

8 0
3 years ago
Other questions:
  • _____ clouds indicate possible precipitation
    6·1 answer
  • I need help, again...
    10·2 answers
  • If you expose HeLa cells to 3H-thymidine just as they enter S phase, then wash this material off the cells and let them go throu
    13·2 answers
  • True or False? Bacterial vaginosis is similar to syphilis in that it is caused by a single organism and is usually a serious inf
    6·1 answer
  • Carlos is analyzing the results of a recent scientific study about gravity. Scientists recorded that the experimental value of g
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How has NYC industrial history impacted growing food in urban soils today ?
    13·1 answer
  • The DNA triplets that code for amino acids are common to-
    6·1 answer
  • If a population is steady at its carrying capacity, but then a group of organisms from that species moves in to the same space o
    15·1 answer
  • CAN SOMEONE PLZ HELP ME!! THIS IS THE 25th TIME I POST THE SAME QUESTION SO PLZ
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!