1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stealth61 [152]
3 years ago
12

A researcher introduces a signal produced by bacteria to eukaryotic cells that she is culturing in the laboratory. Remarkably, s

he notices that this signal results in an increase in eukaryotic gene expression. How is this possible?
A.This gene expression is likely independent of the presence of the prokaryotic signal.

B.The signal is either similar in structure to a ligand used by eukaryotes, or this signaling pathway is utilized by both prokaryotes and eukaryotes.

C.This signaling pathway might actually be utilized by both prokaryotes and eukaryotes.

D.This signal is likely similar in structure to ligands utilized by eukaryotic cells.

E.This prokaryotic signal likely travels directly into eukaryotic cells and acts as a transcription factor.
Biology
1 answer:
Nadusha1986 [10]3 years ago
7 0

Answer:B.The signal is either similar in structure to a ligand used by eukaryotes, or this signaling pathway is utilized by both prokaryotes and eukaryotes.

Explanation: Eucaryotic cell is a cell whose Nucleus is clearly defined and confined within a membrane.

Procaryotic cell is a cell which does not have a clearly defined Nucleus.

Signals are stimuli which can be felt by an organism, specific organismal have its own kinds of signals which it can respond to,but some times signals with specific features can create response in two or more type or species of organisms. What happened in the lab is a case where a partial signal can be sensed by both procaryotes and eucaryotes because it has either a similar structure or its pathway can be used by either Eucaryotic cells and procaryotic cells.

You might be interested in
Which angiosperm feature absorbs water and nutrients from the ground?
Kaylis [27]
I think that the answer is C. roots. I hope that this helps. If it does vote me brainliest please!!
4 0
3 years ago
Read 2 more answers
A farmer planted legumes and cabbage in the same field that is devoid of fertilizers. The yield from this field is better than t
makvit [3.9K]
The correct answer for this question is:
A farmer planted legumes and cabbage in the same field that is devoid of fertilizers. The yield from this field is better than the cabbage planted inanother field without legumes. The reason for this is because (A) <span>nitrogen-fixing present in the roots of legumes aid enrichment of nitrogen in the soil.</span>
5 0
3 years ago
Read 2 more answers
Hello who’s good at biology guys I need someone to help me with the test
Sophie [7]

Answer:

your answer is me

Explanation:

3 0
2 years ago
Lancelets and tunicates are two groups of chordates. classify each statement as applying to lancelets, tunicates, both lancelets
Alenkinab [10]
Characteristics of Lancelets:
Small
Elongated
Marine invertebrate
Lacks a jaw
No sense organs
Has a notochord
Example: Lamprey

Characteristics of Tunicates:
Marine invertebrate
Has an outer coat that is rubbery or hard
Has two siphons
Examples: sea squirts, salps

I hope this is the answer that you were looking for.
7 0
3 years ago
How do scientists measure the amount of dissolved substances in water?
Soloha48 [4]
<span> One is by titration, another is with a meter, and you can also measure it using colorimetric methods.</span>
3 0
3 years ago
Other questions:
  • What is one property of viruses that makes it difficult to cure viral infections
    13·1 answer
  • There are _____ phyla or categories of fish. 2 3 4 5
    9·2 answers
  • Metabolic reactions are necessary for the body to function and maintain homeostasis. Which of the following statements describes
    10·1 answer
  • Can someone help me in this multiple choice question ;)
    15·2 answers
  • A web of proteins in the cytoplasm is known as what?
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What does a poison control center do?
    14·2 answers
  • . What is the function of DNA?
    15·2 answers
  • Which activity causes the least amount of wetland and estuary degradation when it occurs near the coast?
    14·1 answer
  • Which combination of alleles should be here ?number 2
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!