1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vsevolod [243]
3 years ago
9

Thrombocytopenia is characterized by an insufficient number of ____________ due to low production in the bone marrow or ________

____ breakdown outside the bone marrow. Blood flow to the ____________ can stop completely and heart attack or stroke can result from untreated ____________ . An inherited clotting disorder with many forms, generally called ____________ , causes a deficiency in clotting factor. In all forms of this disorder, even the slightest bump causes ____________ in the joints.
Biology
1 answer:
svetoff [14.1K]3 years ago
7 0

Answer:

The correct words are - platelets, increased, tissue, thromboembolism, hemophilia, and bleeding.

Explanation:

Thrombocytopenia is a condition in which the number of platelets decreases significantly in the blood due to less production from the bone marrow or higher or increased breaking down of the platelets.

If the flow of the blood stops completely in between the heart and muscles and can lead to stroke in an individual if thromboembolism is not treated. Hemophilia is a blood condition that is a genetic disorder and inherits from the parents. In which blood does not clots and slightest bumps can lead to bleeding.

You might be interested in
What is the most abundant organic compound on earth
xxTIMURxx [149]

Answer: Cellulose, a component of plant cell walls, is the most abundant organic compound found on earth.

Explanation:

4 0
3 years ago
PLEASE HELP ASAP, WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
o-na [289]
I believe that the correct answer would be : Different types of organisms have different numbers of chromosomes.

I hope that this helps you !
5 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Lions tend to prey on primary consumers like zebras and gazelles. if there were a sudden decline in a population of lions, which
KatRina [158]

There would be an increase in "Zebra" and "Gazelle" population. This is due to the fact that there wouldn't be as many lions to eat the zebras and gazelles, causing their repopulation to become more frequent.

4 0
3 years ago
A nurse is preparing to administer an intravenous piggyback medication to a client who is receiving a continuous infusion of int
sergij07 [2.7K]
T<span>he nurse should assess the patient's prior knowledge and his ability to participate in any education sessions. The nurse should explain to the patient the possible outcomes of each medication. The patient should also be well instructed of the symptoms and other reactions brought about by medication.</span>
3 0
3 years ago
Other questions:
  • The falciform ligament separates the:_________.
    15·1 answer
  • The ancient remains of plants preserved in the earth in the form of coal, oil, and natural gas are called
    11·1 answer
  • Which most closely defines niche? A. a role that a population has within its community B. a unique environment in which an organ
    12·1 answer
  • As a cell grows, the ________________ decreases and the cell must divide or die.
    9·2 answers
  • Which of these is not an accomplishment of the Apollo missions ?
    6·2 answers
  • Why is it important for psychologists to know how the brain functions?
    5·2 answers
  • What removes oxygen from the air?
    5·1 answer
  • Which explanation best describes how water droplets form on the outside of a cold glass?
    9·2 answers
  • Is water a polar molecule? Why or why not?
    13·2 answers
  • Summary about DNA , Genes , Traits , Chromosomes. (Explain &amp; let me know about all 4 words. Summarize all these words.) Writ
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!