In order to maintain neutrality, the negatively charged ions in the salt bridge will migrate into the anodic half-cell. A similar (but reversed) situation is found in the cathodic cell.
<h3>
What purpose does a salt bridge serve in an oxidation process?</h3>
Anions (negatively charged particles) are added to the solution of the oxidation half of the cell by the salt bridge, and cations (positively charged particles) are added to the solution of the reduction half of the reaction.
<h3>
What purpose does the salt bridge serve in a galvanic cell?</h3>
For instance, KCl, AgNO3, etc. In a galvanic cell, such as a voltaic cell or Daniel cell, salt bridges are typically used. A salt bridge's primary job is to assist in preserving the electrical neutrality of the internal circuit. Additionally, it aids in keeping the cell's response from reaching equilibrium.
Learn more about Salt bridge here:-
brainly.com/question/20345420
#SPJ4
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
1) B+3 is ok. The exercise already put B+3. What
-------------------------------------------------------------------------------------------------------------------
2) Ge is a neutral atom because it doesn't have any charge.
Germanium has 32 electrons and 32 protons because its atomic number is 32.
Be careful with that.
Neutral atoms have the same numbers of electrons and protons.
-------------------------------------------------------------------------------------------------------------------
3)
<span>0.310 moles
First, look up the atomic weights of the elements involved.
Atomic weight carbon = 12.0107
Atomic weight hydrogen = 1.00794
Atomic weight sulfur = 32.065
Molar mass (C3H5)2S = 6 * 12.0107 + 10 * 1.00794 + 32.065
= 114.2086 g/mol
Moles (C3H5)2S = 35.4 g / 114.2086 g/mol = 0.309959145 mol
Since there's just one sulfur atom per (C3H5)2S molecule, the number of moles of sulfur will match the number of moles of (C3H5)2S which is 0.310 when rounded to 3 significant digits.</span>
2.
The reason why is because there are 2 available electron spots on the orbital for the oxygen atom. Hydrogen atoms have one proton and one electron, thus, in order to fill the oxygen atom orbital to a full outer shell, a maximum of 2 atoms could bond with the oxygen atoms.
6 electrons (oxygen)+ 1 electron (hydrogen)+ 1 electron (hydrogen)= 8
