1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
5

We use the periodic table to determine a mineral’s hardness true or false

Chemistry
2 answers:
Ray Of Light [21]3 years ago
6 0
False we use it to determine what type of element it is as well as the atomic mass and number
Bas_tet [7]3 years ago
3 0
False we use it to detirmine the reactivitys and what groups they are in
You might be interested in
What is the correct balanced equation for the reaction that occurs when aqueous ammonium chloride reacts with aqueous barium nit
Setler [38]

Answer:

2NH_{4}Cl + Ba(NO_{3} )_{2} ⇒  BaCl_{2} + 2NH_{4}NO_{3}

Explanation:

In balancing a chemical equation we make sure the number of atoms of each element on the reactant side of the equation equals that on the product side

NH_{4}Cl + Ba(NO_{3} )_{2} ⇒  BaCl_{2} + NH_{4}NO_{3}

The equation above represents an unbalanced equation of the reaction of aqueous ammonium chloride  with aqueous barium nitrate .we can balance this equation by adding the right coefficients to reactants and product.

2NH_{4}Cl + Ba(NO_{3} )_{2} ⇒  BaCl_{2} + 2NH_{4}NO_{3}

5 0
3 years ago
What is the best course of action if you are out driving during a thunderstorm?
azamat
The best answer would be A.) stay in the car.

-do not have windows open, and do not touch the outside of the car.
6 0
3 years ago
Give the reason for the following; 1. Iodimetric titrations are usually performed in neutral or mildly alkaline (pH 8) to weakly
Agata [3.3K]

Answer:

Explanation:

blach bal

5 0
3 years ago
Kilauea volcano in hawaii emits 200-300 tons of sulfur dioxide into the atmosphere each day. this is an example of?
o-na [289]

Kilauea volcano in Hawaii emits 200-300 tons of sulfur dioxide into the atmosphere each day. This is an example of

  • the impact of natural processes on the earth's environment.
  • air pollution from a natural source.
  • the magnitude of the chemistry associated with the environment.

Kilauea volcano in Hawaii emits noxious compounds of sulfur dioxide and other harmful pollutants as a result of a reaction with atmospheric water vapors and oxygen.

This reaction results in acid rain and volcanic smog which pollutes the air.

Over the years, the volcano has become a potential threat to health as harmful oxides are accelerating respiratory problems and acid rain destroys crops, and also harms water supplies.

If you need to learn more about the Kilauea volcano click here:

brainly.com/question/22843284

#SPJ4

7 0
2 years ago
What is the mass in grams of 85.32 mL of blood plasma with a density of 1.03 g/mL
sveticcg [70]
<span>Well if you're looking for grams, all you need to do is cancel out units. (ml)(g/ml)=g because the ml cancels out. Thus, multiply: (85.32ml)(1.03g/ml)=...I'll let you solve this. :) Good luck! Hope that helped. When in doubt, look at the units.</span>
3 0
3 years ago
Other questions:
  • If you have one mole of alumibum atoms, what would the mass be
    9·1 answer
  • This is to observe carefully and in detail so as to identify causes, key factors, or possible results
    5·2 answers
  • A solution is prepared by dissolving 91.7 g fructose in 545 g of water. Determine the mole fraction of fructose if the final vol
    12·1 answer
  • The overall reaction in a commercial heat pack can be represented as How much heat is released when 4.40 moles of iron are react
    7·1 answer
  • Which of the following oils would consume the greatest number of equivalents of hydrogen when subject to catalytic hydrogenation
    10·1 answer
  • Witch reaction is a single replacement reaction
    13·1 answer
  • Two substances, A and B, initially at different temperatures, come into contact and reach thermal equilibrium. The mass of subst
    10·1 answer
  • ¿Por qué un trozo de sal común es frágil y se puede romper fácilmente cuando se le somete a una fuerza y no ocurre lo mismo con
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • CO2 and H2O are examples of chemical?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!