1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
3 years ago
9

(39 points) pls help {Brainliest}

Biology
2 answers:
kicyunya [14]3 years ago
7 0

Answer:

Green biotechnology

Explanation:

just did it

vagabundo [1.1K]3 years ago
4 0

Answer:

you already got the answer so ima just type a answer

Explanation:

You might be interested in
A multigravid client admitted to the labor area is scheduled for a cesarean birth under spinal anesthesia. Which client statemen
Gekata [30.6K]

Answer:The anesthetic may cause a severe headache, which is treatable."

Explanation:

Spinal anesthesia is a type of anesthesia which is administered locally using a fine needle between L3 and L4 space or L4 and L5 space in order to avoid injury to the spinal cord. This procedure is usually carried out by a trained health personnel such as:

- a nurse anesthetists and

- anesthesiologists

Spinal anaesthesia can be used in different surgical procedures such as Caesarea sections and to manage pain during vaginal delivery in MULTIGRAVID CLIENTS, which are those clients who has been pregnant more than once.

Caesarean section is usually done while the patient is awake with the use of spinal anaesthesia. Therefore it's important to explain any possible side effects from the drug to the patient which includes a severe type of headache called post-spinal headache and it's treatable.

3 0
3 years ago
**WILL GIVE BRAINLIEST** DNA is a double helix with many regions. Which evidence best explains the structure of DNA? (4 points)
Zielflug [23.3K]

Answer: choice c

Explanation: choice a and choice c are very similar, but the phrasing of the words is different. Genes are made up of DNA.

7 0
3 years ago
Read 2 more answers
--- separate the atria from the ventricles<br> ventricles atria valves none of the above
attashe74 [19]

Atomoxetine (brand name Strattera) is a norepinephrine reuptake inhibitor approved for the treatment of attention deficit hyperactivity disorder (ADHD).This compound is manufactured, marketed, and sold in the United States as the hydrochloride salt (atomoxetine HCl) under the brand name Strattera.https://www.creative-peptides.com/product/atomoxetine-hydrochloride-item-10-101-111-13.html


4 0
3 years ago
Coral reefs cover less than ___ of the ocean floor. <br> A)1% <br> B)2% <br> C)4% <br> D)3%
nikdorinn [45]

Answer:

c

Explanation:

3 0
2 years ago
What are restriction enzymes? what are restriction enzymes? exonucleases that degrade single-stranded dna endonucleases that ran
tangare [24]
Restriction enzymes<span>, also known as </span>restriction endonucleases<span>, are </span>enzymes<span> that cut a DNA molecule at a particular place. They are essential tools for recombinant DNA technology. The </span>enzyme<span> "scans" a DNA molecule, looking for a particular sequence, usually of four to six nucleotides.</span>
6 0
3 years ago
Other questions:
  • Describe what happens in a nuclear fusion reaction.
    8·2 answers
  • Which natural event can occur either over a few weeks or over a few million years?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • which of the following circumstances could be a cause of a miscarriage? a. maternal hormone balance b. genetic normality c. mate
    9·1 answer
  • Which is not a major similarity or difference between freshwater and marine ecosystems?
    15·2 answers
  • How much of a cell in the human body is composed of water?
    7·2 answers
  • A plant and an animal are both living things. According to the Cell Theory, what can you conclude about these two
    14·1 answer
  • Which of the following is an example of a compound?
    13·2 answers
  • Many plants can reproduce both sexually and asexually. For example, rose bushes reproduce asexually when cuttings planted in the
    13·1 answer
  • Please help!!<br>Need the correct answer<br>Urgent<br>Will give the brainliest​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!