1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
2 years ago
6

N2+3h2-->2NH3 How many Nitrogen atoms are in none molecule of Ammonia ? Please help me

Biology
1 answer:
drek231 [11]2 years ago
6 0

Answer:

6

Explanation:

well the question is kinda vague but multiply 3 and 2 and it comes out to 6 electrons by cross multiplying these variables

You might be interested in
What is the food chain in a bass pond
Vanyuwa [196]
  • The type of food chain that exists in a pond is called the grazing food chain. In a pond, the producers are phytoplankton like some algae and submerged plants found at the edges. The consumers have included zooplankton and the last decomposers are some bacteria, fungi, etc found at the bottom of the pond.
6 0
2 years ago
Science provides only a
melomori [17]

Science provides only a limited understanding of the supernatural, or other ways of knowing, such as art, philosophy, or religion is a true statement.

<h3>Why science provide limited information about supernatural?</h3>

Science provides only a limited understanding about supernatural, aesthetic, or other ways of knowing, such as art, philosophy, or religion because they are not proved by the science through experiments. These things are beyond from explaining them. Science can't explain the happening of supernatural phenomenon. Science does not create moral or ethical rules, laws, or judgements. Science deals with only things that can be observed or measured so that's why science is not understanding supernatural things.

So we can conclude that Science provides only a limited understanding of the supernatural, or other ways of knowing, such as art, philosophy, or religion is a true statement.

Learn more about science here: brainly.com/question/17216882

#SPJ1

3 0
1 year ago
A. True
Irina18 [472]
B, false. Vegetarians do not consume the food that is known to cause cancer, meat.
6 0
2 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
2 years ago
While visiting Wave Rock in Australia, you observe streaks of minerals present on the landform. What natural process most likely
Simora [160]
It’s weathering bc it has been smoothing by weathering and water erosion
8 0
3 years ago
Read 2 more answers
Other questions:
  • How does random add to genetic variation ?
    9·1 answer
  • Asthma narrows airways to the lungs and in the lungs by contraction of muscles around the air passages, swelling of the airway l
    14·1 answer
  • Would you expect birds, who require arginine in their diet,<br> toproduce urea? Explain.
    5·1 answer
  • True of false: The wings on an airplane are flat.<br> 1. False<br> 2. True
    15·1 answer
  • How would making an inference be helpful in science​
    15·1 answer
  • In eukaryotes , DNA is found in the cytoplasm of the cell
    8·1 answer
  • Which of the following is a part of a land-based carbon cycle?
    7·1 answer
  • Damage to the basilar membrane is most likely to result in: accommodation. nerve deafness. conduction hearing loss. loss of move
    14·1 answer
  • What kind of electrical charge is found on a hydrogen atom of a polar water molecule
    5·2 answers
  • Because most cigar and pipe smokers do not ______, as a group they have a lower risk of cancer than cigarette smokers.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!