1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
2 years ago
13

If the rate of pumping of groundwater from wells is greater than the rate of infiltration recharging it, can the groundwater be

considered a renewable resource?
Please answer ASAP
Biology
1 answer:
mafiozo [28]2 years ago
4 0

Answer:

No

Explanation:

A renewable resource is one in which the rate at which its being replenished is higher than the rate at which it is being used up.

For example, the air we breathe is a renewable resource because it doesn't get used up as we draw it.

  • If the rate of drawing down a ground water supply exceeds the rate of its recharge, then such a water source is non-renewable.
You might be interested in
An additional gene, gene W, was also examined. A test cross was made between true-breeding EEWW flies and EEWW flies. The result
Debora [2.8K]

This question is incorrect but here is the correct question below;

An additional gene,gene W was also examined. a test cross was made between true breeding EEWW flies and eeww flies. The resulting F₁ generation was then crossed with eeww flies. 100 offspring in the F₂ generation were examined and it was discovered that the E and W genes were not linked.

Which is the correct genotype of the F₂ offspring if the genes were linked and if the genes were not linked?

a) Linked: 50% EeWw and 50% eeww; not linked: 25% EeWw, 25% Eeww, 25% eeWw and 25% eeww.

b) Linked: 25% Eeww, 50% eeWw; not linked:parental genotypes EeWw and eeww.

c) Linked genotypes (EeWw and eeww) and recombinant genotype ( Eeww & eeWw) in the F₂ generation are nearly the same irrespective of their linkage.

d) Linked: mostly with parental genotypes, Eeww and eeWw; unlinked: 25% EeWw and eeww with 75% Eeww and eeWw.

Answer:

a) Linked: 50% EeWw and 50% eeww; not linked: 25% EeWw, 25% Eeww, 25% eeWw and 25% eeww.

Explanation:

a test cross was made between true breeding EEWW flies and eeww flies

If EEWW self crossed, we have the following ( EW, EW, EW, EW)

Also, for eeww, we have ( ew, ew, ew, ew)

                   

                    EW                   EW                     EW                   EW

ew               EWew               EWew               EWew               EWew      

ew               EWew               EWew               EWew               EWew

ew               EWew               EWew               EWew               EWew

ew               EWew               EWew               EWew               EWew

All offspring are  (EWew)

The question goes further by saying "The resulting F₁ generation was then crossed with eeww flies".

And we are asked to find the correct genotype of the F₂ offspring if the genes were linked and if the genes were not linked

∴

To determine  the offsprings of the linked genes we need to go by the definition and understand what linked genes are: Linked genes are genes that are physically close together on the same chromosomes. Effect of recombinantion on linked genes, results in gene swaps which occur in chromosomes that are homologous.

Having said that; If  EWew × eeww

we have;                 EW   &   ew    ×    ew  &    ew

           EW               ew

ew       EeWw          eeww

ew       EeWw          eeww

offspring that

are linked in   ⇒     EeWw    EeWw     &      eeww      eeww

F₂   will be

\frac{1}{2} = 50% of EeWw of the total 100 offspring in the F₂ cross

\frac{1}{2} = 50% of eeww of the total 100 offspring in the F₂ cross

∴ Linked genes =  50% EeWw and 50% eeww.

For unlinked genes; If  EWew × eeww

if rearrangement occurs in EWew  and EWew self crossed, we have ( EW,Ew,eW,ew) as the traits needed for the unlinked gene F₂ crossing.

Also ewew will be (ew, ew, ew, ew).

                       EW                    Ew                    eW                    ew

ew                  EeWw               Eeww                eeWw                eeww

ew                  EeWw               Eeww                eeWw                eeww

ew                  EeWw              Eeww                 eeWw                eeww

ew                  EeWw              Eeww                 eeWw                eeww

We have the following results for the unlinked genes

\frac{1}{4} = EeWw  25% of the total 100 offspring in the F₂ cross

\frac{1}{4} = Eeww   25% of the total 100 offspring in the F₂ cross

\frac{1}{4} = eeWw   25% of the total 100 offspring in the F₂ cross

\frac{1}{4} = eeww    25% of the total 100 offspring in the F₂ cross

∴ not linked: 25% EeWw, 25% Eeww, 25% eeWw and 25% eeww.

3 0
2 years ago
what part of the brain controls body tempertaure and coordinates cardiovascular, respiratory, digestive, excretory functions
Lina20 [59]

Answer:

Hypothalamus

Explanation:

6 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
The standardized taxonomic system is important to the scientific community because it provides several advantages. Which of thes
chubhunter [2.5K]

Answer:

Standard taxonomic system is important to the scientific community because it provide several advantages like that organise and classify the organism that organism can be easily categorised it helps to understand the characteristics of a specific organisms, it also benefited to universal recognition that scientific names are standardised and it is accepted universally and it also help to understand the similarities and differences between different species that belonging to the same genera.

(Drawbacks of modern taxonomy) :it is based on physical traits and it is also physically similar and species may not be related and it does not use molecular evidence

5 0
3 years ago
What is the central Nervous system (cns)​
Allisa [31]

Answer:

the complex of nerve tissues that controls the activities of the body. In vertebrates it comprises the brain and spinal cord.

Explanation:

^

4 0
2 years ago
Other questions:
  • Who developed a rabies vaccine after realizing the disease was caused by something smaller than a bacterium?
    9·1 answer
  • Which of the following organelles are common in both prokaryotic and eukaryotic cells
    10·1 answer
  • A bike travels 4 miles in half an hour (0.5), what is its speed
    9·1 answer
  • Which of the following statements is true about biomes?
    11·1 answer
  • For short term energy needs, glucose can be released from storages of ____________ chains.
    14·1 answer
  • if cellular respiration took place in just one step most of the ___ would be lost in the form of light and___
    7·1 answer
  • What are some characteristics of scientific questions ?
    6·1 answer
  • Imagine that two protein kinases, PK1 and PK2, act sequentially in an intracellular signaling pathway. When either kinase is com
    15·1 answer
  • Which process is the main source of movement
    10·2 answers
  • The element of this cycle makes up 78% of the atmosphere
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!