1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
2 years ago
9

While diapering her 1 year old

Biology
1 answer:
zzz [600]2 years ago
8 0

Answer:

?

Explanation:

what is the full thing

You might be interested in
The female Anopheles Mosquito is vector for the malarial pathogen.
klemol [59]
Malaria is transmitted among humans by female mosquitoes of the ... The successful development of the malaria parasite in the mosquito (from ... The adult stage is when the female Anopheles mosquito acts as <span>malaria vector</span>.
3 0
3 years ago
When a litter of puppies is born, the pups will exhibit certain physical characteristics that can be found in one or both of the
S_A_V [24]

Answer:

Inherited traits.

Explanation:

Inherited traits are ones passed down from parent to offspring!

8 0
2 years ago
Read 2 more answers
Describe two examples of steroids. For Each example, describe its physiological function
guapka [62]
<span>Steroids are like hormones that greatly influences bodily activities mostly in growth and function. These functions may modify, change and control one’s body organs or system that’ll vary in form, shape or structure due to these hormone-like compounds and also, it can affect one’s psychological and neurological state. There are several types of steroids. Examples can include: </span><span><span>
1. </span>Sex steroids. These are can influence reproduction and sex characteristics.</span> <span><span>
2. </span>Anabolic steroids. Most abused in many athletic activities. These steroids are used for muscle and bone growth.<span>
</span></span>
4 0
3 years ago
gHow would an inhibitor of cAMP phosphodiesterase affect glucose mobilization in muscle? It would reduce cAMP levels and inhibit
Ksivusya [100]
<h2>cAMP and glucose mobilization</h2>

Explanation:

It would maintain high cAMP level and elevate glucose mobilization

  • Phosphodiesterase is an effector enzyme which degrades secondary messenger cAMP(cyclic adenosine monophosphate)
  • Here in this case an inhibitor is inhibiting the phosphodiesterase therefore cAMP level will increase
  • As cAMP level rise it activates a protein called protein kinase A which phosphorylates phosphorylase kinase and activates it
  • Phosphorylase kinase becomes active that phosphorylates glycogen phosphorylase and makes it active,glycogen phosphorylase catalyse breakdown of glycogen(in liver and muscle cells)
  • In liver cells breakdown of glycogen occurs and glucose 1 phosphate gets converted into glucose and supplied to whole body through blood

7 0
3 years ago
Once transported, the monosaccharides,amino acid,electrolytes, and water will be transported by what
irina [24]
Their transported by what
4 0
3 years ago
Other questions:
  • Compared with deciduous forests, coniferous forests _____. tend to contain more broadleaf evergreen trees are more likely to be
    14·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • The traditional view of mangrove forests as wastelands and unhealthy environments helped promote their degradation because _____
    7·1 answer
  • Gregor mendel crossbred pea plants for a variety of traits. What did he learn about dominant and recessive traits?
    11·1 answer
  • which of these describes the process of blending human and material resources through a formal structure of tasks and authority;
    12·1 answer
  • What is the diffrence between working in a field or laboratory
    13·1 answer
  • Colorblindness is caused by a recessive x-linked gene. a woman that is heterozygous for this trait marries a man with normal col
    6·1 answer
  • A scientist is examining the role of an element found in fats and carbohydrates of living things. This element makes up 65% of h
    5·1 answer
  • 1)What two processes fuel the carbon cycle?
    7·2 answers
  • DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complement
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!