1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phantasy [73]
3 years ago
12

most cells underego apoptosis if their dna is damaged. How can this be beneficial to an organism? someone pls help

Biology
1 answer:
Vesna [10]3 years ago
8 0

Answer:

It prevents the cell from passing on those defects to other cells through DNA replication in cell division. By self destructing before it gets the chance to divide, whatever problem the cell had ends right there and doesn't propagate in the organism.

You might be interested in
HELP ASAPPP PLEASEEEEE
Kitty [74]

The birth rate was greater than the death rate and the immigration rate was greater than the emigration rate. Options B and D are correct.

<h3>Population growth</h3>

From the illustrated image, the world experienced an upward growth in population between 1950 and 2010.

In order for population growth to occur:

  • the birth rate must exceed the death rate
  • immigration must exceed emigration

Either or both of the above conditions will lead to a growth in the population.

Thus, options B and D are correct.

More on population growth can be found here: brainly.com/question/18415071

#SPJ1

8 0
1 year ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
When amino acids are degraded for energy or glucose production, their amine groups are incorporated by the liver into ____.
masya89 [10]

Answer:

The correct answer is - urea.

Explanation:

In our body, to produce energy or produce glucose our body breaks the amino acids, it gets from proteins mainly. These amino acids are mainly breakdown into amine groups.

The human body has a unique ability to pack ammonia(amine group) by converting it to urea and incorporated and produced by the liver using 2 molecules of ammonia (NH3) and 1 molecule of carbon dioxide (CO2).  This incorporated urea is then secreted from the liver and incorporated into the urine in the kidney for further process.

8 0
2 years ago
Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
allochka39001 [22]

Answer:

Decomposers

Explanation:

Decomposers eat decaying or dead organisms to produce the nutrients.

8 0
2 years ago
Science is always changing and never completely proves anything because
Korolek [52]
Most things can't be explained or it hasn't been discovered yet. Science is all about asking questions and figuring out how things are the way they are.
6 0
3 years ago
Other questions:
  • The concept that living cells only arise from preexisting living cells is called:
    14·1 answer
  • The term "myoparesis" is used to describe: weakness or slight muscular paralysis increase in muscle movement protrusion of muscl
    14·1 answer
  • How are the problems different
    13·1 answer
  • What is the brain made out of?
    11·2 answers
  • True or False: Mitosis results in four genetically different haploid cells.
    13·2 answers
  • This cell is in which stage of mitosis?
    11·1 answer
  • What happens during photophosphorylation
    11·2 answers
  • Which is a better source of water vapor, landmasses or oceans?
    15·2 answers
  • DNA includes the instructions for building __________.
    8·1 answer
  • According to the theory of natural selection some individuals in a population survive while others die he proposed that survival
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!