1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mezya [45]
3 years ago
8

What is a method of calculating density for an irregular object called

Biology
1 answer:
ivolga24 [154]3 years ago
4 0

Answer:

I believe it is  (mass/volume).

You might be interested in
Explain how parasitism differs from commensalism.
babymother [125]
<span>Commensalism is an interaction in which one of those species would benefit, and the other one would not be affected. Parasitism is an interaction in which one of those species would benefit at the expense of the host organism. Thus, in commensalism we have one positive and one neutral result while in parasitism we have one positive and one negative result.</span>
8 0
3 years ago
Read 2 more answers
What part of a cell carries out waste removal
maria [59]

Answer:

<h2>iysosome </h2>

Explanation:

hope it helps u

6 0
2 years ago
Write two examples and two characteristics of monocot and dicot plant​
Sophie [7]

Answer:

MONOCOTS                                                  DICOTS

Embryo with single cotyledon           Embryo with two cotyledons

Pollen with single furrow or pore          Pollen with three furrows or pores

Flower parts in multiples of three      Flower parts in multiples of four or five

Major leaf veins parallel                  Major leaf veins reticulated

Explanation:

Monocots include most of the bulbing plants and grains, such as agapanthus, asparagus, bamboo, bananas, corn, daffodils, garlic, ginger, grass, lilies, onions, orchids, rice, sugarcane, tulips, and wheat.

8 0
3 years ago
Read 2 more answers
How does population growth negatively impact water quality?
Lesechka [4]
The more the people, the more  pollutant they generate which will pollute the the water.
5 0
3 years ago
What is the difference between a scientific theory and a law?
nekit [7.7K]

Answer:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory

Explanation:

6 0
3 years ago
Other questions:
  • Is neon an atom, element, molecule, or a compound?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following statements presents a reasonable conclusion?
    5·2 answers
  • Which term refers to the organism eaten by a predator
    7·1 answer
  • Through the process of meiosis, sex cells are produced that are what?
    10·1 answer
  • Many sources of water pollution are found within the home. What actions can you take to reduce water pollution.
    13·1 answer
  • There are several types of Monera that are harmful to humans. Research a harmful monera (salmonella is an example) and write a t
    6·2 answers
  • Write a sentence that relates your model to processes that take place inside your own cells. Your answer should include some for
    10·1 answer
  • How does a change at the molecular level lead to a change in phenotype?.
    8·1 answer
  • Suppose the rate of plant growth on isle royale supports an equilibrium moose population of 850 moose in this scenario there are
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!