1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bumek [7]
3 years ago
10

A scientist claims that he has protected animal test subjects from a newly mutated virus using an experimental vaccine. The expe

rimental vaccine was injected into five animal test subjects. The scientist also injected a placebo vaccine into five other animal test subjects. One month later, all of the test subjects were exposed to the mutated virus. The subjects that received the vaccination showed no sign of the disease and blood tests confirmed the presence of antibodies against the disease, but the subjects given the placebo developed symptoms of this condition. Why did one group have a placebo injected before being exposed to the virus? Choose 1 answer: Choose 1 answer: (Choice A) A They were part of the control group (Choice B) B They would be exposed to a weakened form of the virus (Choice C) C They would be protected from the disease (Choice D) D They were part of the experimental group
Biology
1 answer:
Oliga [24]3 years ago
5 0

Answer:

A. They were part of the control group

Explanation:

In a scientific experiment, the CONTROL GROUP as opposed to the experimental group is the group that does not receive the experimental treatment. This acts as a standard for comparison.

In this question, the EXPERIMENTAL VACCINE is the experimental treatment or independent variable that was added. The five animal test subjects that was injected with this vaccine are called the EXPERIMENTAL GROUP while the other five test subjects that were rather injected with a PLACEBO are called CONTROL GROUPS.

You might be interested in
These statements describe three different reactions.
Arte-miy333 [17]

Answer: 2 - The nucleus of an atom is split apart

Explanation: Any reaction involving the nucleus of an atom is called a nuclear reaction. It is different from ordinary chemical reactions that involve electrons because it involves the release of large amount of energy. Nuclear reactions can be classified as nuclear fission and nuclear fusion.

A nuclear reaction in which a nucleus of an atom is split into two smaller atoms with a release of large amount of energy is called nuclear fission. A nuclear reaction that involves the combination of lighter nuclei of elements to form heavier atoms that are more stable with the release of a large quantity of energy is called nuclear fusion.

5 0
4 years ago
Help I need this done thx.
shusha [124]
Flagelle - 4
Pseudopod - 2
Autotroph - 8
Prokaryote - 1
Heterotroph - 3

Hope this helps ;)
6 0
3 years ago
of the following biological levels of organization, which represents the smallest or lowest level? A.organs B.populations.c.cell
GuDViN [60]
C. Cells

Cells make up organs, which make up organisms, which make up populations
5 0
3 years ago
Which 2 biomes have the least precipitation ?
Natasha_Volkova [10]
Desert tundra gang members
3 0
4 years ago
Read 2 more answers
Which describes the foramen magnum?
Yuri [45]
The foramen magnum is really important feature for bipedal mammals (basically, animals that walk on two feet). It's basically a whole in the base of the skull that allows the spinal cord to connect the lower body to the brain. Hope this helps!
6 0
3 years ago
Read 2 more answers
Other questions:
  • A diaphragmatic hernia will most likely result in ______ collapse.
    11·2 answers
  • Compare the physical and chemical properties of a compound to those of the elements of which it is composed.
    9·2 answers
  • What are two advantages of setting up instruments for measuring carbon dioxide on top of mauna loa​
    12·1 answer
  • Why is it important to remember that people are part of the environment too?
    7·2 answers
  • if you were an importer of goods to China, what age group(s) do you think you would focus on the most? Why?
    5·1 answer
  • The non essential part of a flower are the​
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is an upwelling? how is it benifical?
    10·2 answers
  • . Landfill are is a/an: (a) open area (b) high lying open area (c) open area near a river/lake (d) low lying open area
    15·1 answer
  • What creates a positive charge inside the cell during a nerve impulse?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!