D prevents repeating. experiments have to be repeated to be reliable.
A hypnosis effects the brain because it helps your brain better understand what you don't.
<span>Diversity of the species. Asexual reproduction is in effect a form of cloning - in that the offspring are created from the 'mother' - and contain only one set of genes. Sexual reproduction - is the joining of an egg and sperm from two different parents - thus 'mixing' the genes from both donors. Hope this helps, good luck. </span>
Four human impacts on the lithosphere brought on through agriculture are: 1. Increased salinity of the surrounding environment due to pesticide and fertilizer use. 2. Increased soil erosion due to the destruction of the native, protective canopy. 3. Decreased soil productivity due to the overuse of land. 4. Increased pollutants in the groundwater table due to chemical use and/or lower levels of the water table to irrigation and then runoff or evaporation.
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
