1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zheka24 [161]
3 years ago
13

Experimental Overview Data and Observations Analysis and Discussion Conclusions Conventions and

Law
1 answer:
8090 [49]3 years ago
6 0

Answer: ablishes the central question

of the experiment, provides a

Explanation:

method for achieving t

You might be interested in
People who traveled to Fort Union often had to take a train before traveling on the Santa Fe Trail. Describe two of the conditio
Volgvan

Answer:

The Santa Fe Trail was America’s first commercial highway. Traders established the trail—which connected Missouri to Santa Fe, New Mexico and covered some 900 miles of the Great Plains—in 1821. Before its demise due to the completion of the Santa Fe railroad, the Santa Fe Trail served as a thoroughfare for countless traders, pioneers and America’s military, and it played a crucial role in America’s westward expansion.

7 0
3 years ago
What is symbol 31 in auto insurance
bija089 [108]
Answer: Symbol 31 covers dealers “auto” and “autos” held for sale by non dealers or trailers dealers.
5 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
generally, how many supreme court justices have to agree to review a case from the us courts of appeals?
svetoff [14.1K]

Answer:

Four out of Nine need to agree

5 0
3 years ago
Which of the following is NOT a basic element of communication?
Anastaziya [24]

Answer: It would be C.) Thought Process!

Explanation: Hope That Helped Love!<3

3 0
3 years ago
Read 2 more answers
Other questions:
  • When your driver license is _____, it's considered void and terminated. A. expunged B. suspended C. canceled D. renewed
    12·2 answers
  • Who served as the first<br>chief justice of the Supreme<br>Court​
    13·2 answers
  • When the Supreme Court determines the constitutionality of a law, it is using
    11·1 answer
  • Jay is fired from his job and sues his employer. Jay loses the trial, and he appeals. The reviewing court affirms the decision o
    6·1 answer
  • Outline current crime and disorder legislation
    11·1 answer
  • Give your own example of the 5th Amendment.
    15·2 answers
  • It is possible to amend (or change) a bill in committee or on the floor during debate.
    15·2 answers
  • Utilerarism is crisitized for asking or requiring us
    8·1 answer
  • The worst answer to “being informed” and responding to an Active Shooter / Threat, is? Choose the best answer from the list of a
    10·1 answer
  • Which constitutional provisions limit the power of government.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!