1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
2 years ago
12

. Answer the following questions for the problem of antibiotic-resistant bacteria.

Biology
1 answer:
MA_775_DIABLO [31]2 years ago
5 0

Answer:

antibiotics resistant occur when the body build up a resistance to antibiotics

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What would happen to a species if they no longer reproduced?
Eva8 [605]
They would become extinct.
8 0
3 years ago
In a lake with three trophic levels (non-native fish, zooplankton, algae), an algal bloom occurs when the small population of zo
tino4ka555 [31]

Answer:

Zooplankton help other populations survive by keeping out other herbivores

Explanation:

This is because a keystone species are species that have large effect on the the habitat and through its effect they help to keep the ecosystem in existence. They make sure that the ecosystem exist. They help populations survive by keeping out herbivores and feeding on the algae. They help drive nutrients cycle and transfer energy from algae to invasive fish.

7 0
3 years ago
You and other scientists have been able to get the same results after many experiments. What is this proven data called?
Katena32 [7]
Add more Subjects or do It again

8 0
3 years ago
Which are vectors?<br><br><br> animals<br> water<br> air<br> food<br> objects
Rainbow [258]
Objects are vectors
3 0
2 years ago
Read 2 more answers
Other questions:
  • Computer modeling gives scientists the ability to study the interaction of complicated systems
    8·1 answer
  • What is meant by the scientific term "blob”?
    5·1 answer
  • Plants have mitochondria in this cells break down glucose to make into ATP.
    14·1 answer
  • Using the processes of diffusion and osmosis molecules(particles) always move from?
    14·2 answers
  • Which events take place in the light-dependent reactions of photosynthesis?
    7·1 answer
  • What process is happening in the reaction shown below?
    7·1 answer
  • Match the following.
    15·1 answer
  • In a single called organism mitosis is used for
    8·1 answer
  • b. Describe how an effort to preserve a species of elephant could affect an area where elephants have been hunted extensively. (
    14·1 answer
  • Drug-resistant populations of microbes arise when: Group of answer choices exposure to drugs causes mutations that produce resis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!