1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolezko [41]
3 years ago
5

Which process produces two copies of the original dna molecule

Biology
2 answers:
iVinArrow [24]3 years ago
8 0

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ The correct answer choice is B. DNA replication. DNA replication takes place in interphase during mitosis and meiosis.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

faust18 [17]3 years ago
3 0
CORRECT ANSWER:

B. DNA Replication

This process produces two copies DNA from an original DNA molecule.

INCORRECT ANSWERS

A. DNA ligation sort of “glues” two ends together.

C. DNA transcription creates an single-stranded mRNA copy of a single strand of DNA.

D. DNA translation creates a protein from the mRNA copy created during transcription.
You might be interested in
Higher forms of life such as humans and other mammals generally reproduce-
AleksAgata [21]

Answer:

B- only sexually

Explanation:

Higher forms of life generally reproduce sexually in order to increase the amount of genetic variation within their population. I hope this helps!

5 0
3 years ago
Which medical term means a small circumscribed elevation on the skin?
ycow [4]
The answer is papule. 
5 0
3 years ago
Why is the Earth separated into different layers?
Marysya12 [62]
The waves do not help scientist
3 0
3 years ago
Carbon dioxide is constantly exchanged among the atmosphere, ocean, and land. Carbon dioxide is produced and absorbed by microor
Darya [45]

The answer is actually B

3 0
3 years ago
Read 2 more answers
A 35-year-old male complains of a "pressure" type headache to the back of his head and neck. He states that he woke up with the
tigry1 [53]

Answer:

Answer is D. Tension

Explanation:

Tension headache is a type of headache that can be described as feeling of dull or moderate pain in the head, which can be inform of a tightness around the head and the neck.Tension headache is also known as stress headache.

It has been discovered that, various activities like driving for a long period of time, staring to a computer for a long period and exposure to cold temperature, can cause tension headache.

The following activities can be developed to reduce or avoid tension headache.

* Drinking a lot of water.

* Regular exercise.

* Sleeping very well

* Limiting stress

* Eating foods like almond and walnut.

In this case, the complaint of a 'pressure' type headache to the back of the head and neck by the man, was a typical feeling ,synonymous to tension headache.

3 0
3 years ago
Other questions:
  • Deserts are increasing world-wide. This is known as _____.
    14·1 answer
  • In Dr. Losos’s experiment, why was it important that the experimental islands lacked lizards?
    9·1 answer
  • Who/what use cactus as an energy source?
    15·1 answer
  • Which statement accurately describes natural selection
    6·2 answers
  • Explain the significance of the threat that an invasive species brings to an ecosystem.
    15·2 answers
  • In general, geographical isolation occurs when
    14·1 answer
  • 1. What is genotype?
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • PLEASE HELP ASAP<br> What are the three stop codons? What is the start codon?
    6·1 answer
  • A que se le llama impulsor nervioso?<br>​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!